term paper on rice

Information

• Author Services

Initiatives

You are accessing a machine-readable page. In order to be human-readable, please install an RSS reader.

All articles published by MDPI are made immediately available worldwide under an open access license. No special permission is required to reuse all or part of the article published by MDPI, including figures and tables. For articles published under an open access Creative Common CC BY license, any part of the article may be reused without permission provided that the original article is clearly cited. For more information, please refer to https://www.mdpi.com/openaccess .

Feature papers represent the most advanced research with significant potential for high impact in the field. A Feature Paper should be a substantial original Article that involves several techniques or approaches, provides an outlook for future research directions and describes possible research applications.

Feature papers are submitted upon individual invitation or recommendation by the scientific editors and must receive positive feedback from the reviewers.

Editor’s Choice articles are based on recommendations by the scientific editors of MDPI journals from around the world. Editors select a small number of articles recently published in the journal that they believe will be particularly interesting to readers, or important in the respective research area. The aim is to provide a snapshot of some of the most exciting work published in the various research areas of the journal.

Original Submission Date Received: .

• Active Journals
• Find a Journal
• Journal Proposal
• Proceedings Series
• For Authors
• For Reviewers
• For Editors
• For Librarians
• For Publishers
• For Societies
• For Conference Organizers
• Open Access Policy
• Institutional Open Access Program
• Special Issues Guidelines
• Editorial Process
• Research and Publication Ethics
• Article Processing Charges
• Testimonials
• Preprints.org
• SciProfiles
• Encyclopedia

Article Menu

• Subscribe SciFeed
• Recommended Articles
• Google Scholar
• on Google Scholar
• Table of Contents

Find support for a specific problem in the support section of our website.

Please let us know what you think of our products and services.

Visit our dedicated information section to learn more about MDPI.

JSmol Viewer

Rice for food security: revisiting its production, diversity, rice milling process and nutrient content.

1. Introduction

2. global rice production, consumption, and ending stock, 3. variety of rice, 3.1. white rice, 3.2. brown rice, 3.3. fragrant rice, 3.4. basmati rice, 3.5. ponni rice, 3.6. glutinous or waxy rice, 3.7. red rice, 3.8. japonica rice, 3.9. weedy or red rice, 3.10. golden rice, 4. composition of rice grain, 4.1. rice anatomy, 4.2. starch, 4.3. protein, 4.4. lipids, 4.5. non-starch polysaccharides, 4.6. phenolic compound, 4.6.1. phenolic acids, 4.6.2. flavonoids, 4.6.3. proanthocyanidins and anthocyanins, proanthocyanidins, anthocyanins, 4.7. volatile components, 5. nutritional value of rice, 6. rice processing, 6.1. storage of paddy, 6.2. paddy drying, 6.3. cleaning and destoning, 6.4. dehusking and separation of husk, 6.5. whitening and polishing, 6.6. rice grading, 7. environmental impacts of rice cultivation, 8. challenges to overcoming barriers and current policy directions, 9. conclusions, author contributions, institutional review board statement, informed consent statement, data availability statement, conflicts of interest.

• Zhao, M.; Lin, Y.; Chen, H. Improving nutritional quality of rice for human health. Theor. Appl. Genet. 2020 , 133 , 1397–1413. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• FAOSTAT. Production/Yield Quantities of Rice, Paddy in World + (Total). Food and Agriculture Organization of the United Nations, 2021. Available online: https://www.fao.org/faostat/en/#data/QCL/visualize (accessed on 1 September 2021).
• USDA. World Rice Production 2021/2022. 2022. Available online: http://www.worldagriculturalproduction.com/crops/rice.aspx/ (accessed on 1 September 2021).
• Bandumula, N. Rice Production in Asia: Key to Global Food Security. Proc. Natl. Acad. Sci. India Sect. B Biol. Sci. 2018 , 88 , 1323–1328. [ Google Scholar ] [ CrossRef ]
• OECD/FAO. OECD-FAO Agricultural Outlook 2021–2030 ; OECD Publishing: Paris, France, 2021; pp. 7–8. [ Google Scholar ] [ CrossRef ]
• Van Oort, P.A.J.; Saito, K.; Tanaka, A.; Amovin-Assagba, E.; Van Bussel, L.G.J.; Van Wart, J.; de Groot, H.; van Ittersum, M.K.; Cassman, K.G.; Wopereis, M.C.S. Assessment of rice self-sufficiency in 2025 in eight African countries. Glob. Food Secur. 2015 , 5 , 39–49. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• AMIS. AMIS MARKET MONITOR No. 94—December 2021. 2021. Available online: http://www.amis-outlook.org/fileadmin/user_upload/amis/docs/Market_monitor/AMIS_Market_Monitor_Issue_94.pdf (accessed on 1 October 2021).
• FAO. Crop Prospects and Food Situation—Quarterly Global Report No. 2, July 2021. Rome. 2021. Available online: https://doi.org/10.4060/cb5603en (accessed on 1 September 2021).
• von Goh, E.; Azam-Ali, S.; McCullough, F.; Mitra, S.R. The nutrition transition in Malaysia; Key drivers and recommendations for improved health outcomes. BMC Nutr. 2020 , 6 , 32. [ Google Scholar ] [ CrossRef ]
• Statista. Rice Consumption Worldwide in 2021/2022, by Country (in 1000 metric tons). 2021. Available online: https://www.statista.com/statistics/255971/top-countries-based-on-rice-consumption-2012-2013/ (accessed on 1 September 2021).
• International Rice Research Institute. Rice Consumption with Center Pivots and Linears ; International Rice Research Institute: Los Baños, Philippines, 2013; Volume 12. [ Google Scholar ]
• Schreinemachers, P.; Simmons, E.B.; Wopereis, M.C.S. Tapping the economic and nutritional power of vegetables. Glob. Food Secur. 2018 , 16 , 36–45. [ Google Scholar ] [ CrossRef ]
• Samal, P.; Babu, S. The shape of rice agriculture towards 2050. In Proceedings of the 30th International Conference of Agricultural Economists, Vancouver, BC, Canada, 28 July–2 August 2018. [ Google Scholar ]
• Reardon, T.; Tschirley, D.; Liverpool-Tasie, L.S.O.; Awokuse, T.; Fanzo, J.; Minten, B.; Vos, R.; Dolislager, M.; Sauer, C.; Dhar, R.; et al. The processed food revolution in African food systems and the double burden of malnutrition. Glob. Food Secur. 2021 , 28 , 100466. [ Google Scholar ] [ CrossRef ]
• Fukagawa, N.K.; Ziska, L.H. Rice: Importance for global nutrition. J. Nutr. Sci. Vitaminol. 2019 , 65 , S2–S3. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Chauhan, B.S.; Jabran, K.; Mahajan, G. Rice Production Worldwide ; Springer: Cham, Switzerland, 2017; pp. 1–563. [ Google Scholar ] [ CrossRef ]
• Priya, T.S.R.; Nelson, A.R.L.E.; Ravichandran, K.; Antony, U. Nutritional and functional properties of coloured rice varieties of South India: A review. J. Ethn. Foods 2019 , 6 , 11. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Calingacion, M.; Laborte, A.; Nelson, A.; Resurreccion, A.; Concepcion, J.C.; Daygon, V.D.; Mumm, R.; Reinke, R.; Dipti, S.; Bassinello, P.Z.; et al. Diversity of global rice markets and the science required for consumer-targeted rice breeding. PLoS ONE 2014 , 9 , e85106. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Qiu, X.; Pang, Y.; Yuan, Z.; Xing, D.; Xu, J.; Dingkuhn, M.; Li, Z.; Ye, G. Genome-wide association study of grain appearance and milling quality in a worldwide collection of Indica rice germplasm. PLoS ONE 2015 , 10 , e145577. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Weerawatanakorn, M.; Wu, J.C.; Pan, M.H.; Ho, C.T. Reactivity and stability of selected flavor compounds. J. Food Drug Anal. 2015 , 23 , 176–190. [ Google Scholar ] [ CrossRef ] [ PubMed ] [ Green Version ]
• BERNAS. Rice Type in Malaysia. 2022. Available online: https://www.bernas.com.my/bernas/index.php/ricepedia/rice-type-in-malaysia (accessed on 1 January 2022).
• Cho, D.H.; Lim, S.T. Germinated brown rice and its bio-functional compounds. Food Chem. 2016 , 196 , 259–271. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Xie, W.; Li, Y.; Li, Y.; Ma, L.; Ashraf, U.; Tang, X.; Pan, S.; Tian, H.; Mo, Z. Application of γ-aminobutyric acid under low light conditions: Effects on yield, aroma, element status, and physiological attributes of fragrant rice. Ecotoxicol. Environ. Saf. 2021 , 213 , 111941. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Singh, V.; Singh, A.K.; Mohapatra, T.; Krishnan, S.G.; Ellur, R.K. Pusa Basmati 1121—A rice variety with exceptional kernel elongation and volume expansion after cooking. Rice 2018 , 11 , 19. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Bera, A. Basmati rice: A new hope for farmers. Agric. Food e-Newslett. 2020 , 2 , 819–821. [ Google Scholar ] [ CrossRef ]
• Prodhan, Z.H.; Qingyao, S. Rice Aroma: A Natural Gift Comes with Price and the Way Forward. Rice Sci. 2020 , 27 , 86–100. [ Google Scholar ] [ CrossRef ]
• Ramasamy, S.; Robin, S.I.; Muthurajan, R. Developing improved versions of a popular rice variety (Improved White Ponni) through marker assisted backcross breeding. Green Farming 2020 , 8 , 506–511. [ Google Scholar ]
• Ramchander, S.; Ushakumari, R.; Arumugam, M.P. Quality characteristics of rice mutants generated through gamma radiation in white ponni quality characteristics of rice mutants generated through gamma radiation in white ponni. Int. J. Agric. Sci. 2015 , 7 , 719–723. [ Google Scholar ]
• Nawaz, M.A. Processing and Quality of Glutinous Rice ; The University of Queensland: St. Lucia, QLD, Australia, 2018. [ Google Scholar ]
• Qiu, S.; Abbaspourrad, A.; Padilla-Zakour, O.I. Changes in the Glutinous Rice Grain and Physicochemical Electric Field. Foods 2021 , 10 , 395. [ Google Scholar ] [ CrossRef ]
• Agustin, A.T.; Safitri, A.; Fatchiyah, F. Java red rice ( Oryza sativa L.) nutritional value and anthocyanin profiles and its potential role as antioxidant and anti-diabetic. Indones. J. Chem. 2021 , 21 , 968–978. [ Google Scholar ] [ CrossRef ]
• Gong, M.; Zhou, Z.; Liu, S.; Zhu, S.; Li, G.; Zhong, F.; Mao, J. Dynamic changes in physico-chemical attributes and volatile compounds during fermentation of Zhenjiang vinegars made with glutinous and non-glutinous japonica rice. J. Cereal Sci. 2021 , 100 , 103246. [ Google Scholar ] [ CrossRef ]
• Ratnasekera, D. Weedy rice: A threat to rice production in Sri Lanka. J. Univ. Ruhuna 2015 , 3 , 2. [ Google Scholar ] [ CrossRef ]
• Dimitrovski, T.; Andreevska, D.; Andov, D. Morphological and grain characterisation of Macedonian weedy rice ( Oryza sativa L.). Maced. J. Ecol. Environ. 2018 , 20 , 5–17. [ Google Scholar ]
• de Steur, H.; Stein, A.J.; Demont, M. From Golden Rice to Golden Diets: How to turn its recent approval into practice. Glob. Food Secur. 2022 , 32 , 100596. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Dubock, A. The present status of Golden Rice. J. Huazhong Agric. 2014 , 33 , 69–84. [ Google Scholar ]
• Rodríguez, A.V.; Rodríguez-Oramas, C.; Velázquez, E.S.; de la Torre, A.H.; Armendáriz, C.R.; Iruzubieta, C.C. Myths and Realities about Genetically Modified Food: A Risk-Benefit Analysis. Appl. Sci. 2022 , 12 , 2861. [ Google Scholar ] [ CrossRef ]
• Zhu, Q.; Zeng, D.; Yu, S.; Cui, C.; Li, J.; Li, H.; Chen, J.; Zhang, R.; Zhao, X.; Chen, L.; et al. From Golden Rice to aSTARice: Bioengineering Astaxanthin Biosynthesis in Rice Endosperm. Mol. Plant 2018 , 11 , 1440–1448. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Swamy, B.M.; Samia, M.; Boncodin, R.; Marundan, S.; Rebong, D.B.; Ordonio, R.L.; Miranda, R.T.; Rebong, A.T.O.; Alibuyog, A.Y.; Adeva, C.C.; et al. Compositional Analysis of Genetically Engineered GR2E ‘golden Rice’ in Comparison to That of Conventional Rice. J. Agric. Food Chem. 2019 , 67 , 7986–7994. [ Google Scholar ] [ CrossRef ]
• Mallikarjuna Swamy, B.P.; Marundan, S.; Samia, M.; Ordonio, R.L.; Rebong, D.B.; Miranda, R.; Alibuyog, A.; Rebong, A.T.; Tabil, M.A.; Suralta, R.R.; et al. Development and characterization of GR2E Golden rice introgression lines. Sci. Rep. 2021 , 11 , 2496. [ Google Scholar ] [ CrossRef ]
• Hoogenkamp, H.; Kumagai, H.; Wanasundara, J.P.D. Rice Protein and Rice Protein Products ; Elsevier Inc.: Amsterdam, The Netherlands, 2017. [ Google Scholar ] [ CrossRef ]
• Cornejo-Ramírez, Y.I.; Martínez-Cruz, O.; del Toro-Sánchez, C.L.; Wong-Corral, F.J.; Borboa-Flores, J.; Cinco-Moroyoqui, F.J. The structural characteristics of starches and their functional properties. CYTA-J. Food 2018 , 16 , 1003–1017. [ Google Scholar ] [ CrossRef ]
• Zhang, H.; Jang, S.G.; Lar, S.M.; Lee, A.R.; Cao, F.Y.; Seo, J.; Kwon, S.W. Genome-Wide Identification and Genetic Variations of the Starch Synthase Gene Family in Rice. Plants 2021 , 10 , 1154. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Belitz, H.-D.; Rosch, W.; Schieberle, P. Food Chemistry ; Elsevier: Amsterdam, The Netherlands, 2009. [ Google Scholar ] [ CrossRef ]
• Bertoft, E. Understanding starch structure: Recent progress. Agronomy 2017 , 7 , 56. [ Google Scholar ] [ CrossRef ]
• Maung, T.Z.; Yoo, J.M.; Chu, S.H.; Kim, K.W.; Chung, I.M.; Park, Y.J. Haplotype Variations and Evolutionary Analysis of the Granule-Bound Starch Synthase I Gene in the Korean World Rice Collection. Front. Plant Sci. 2021 , 12 , 707237. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Madhusankha, G.D.M.; Thilakarathna, R.C. Meat tenderization mechanism and the impact of plant exogenous proteases: A review. Arab. J. Chem. 2020 , 14 , 102967. [ Google Scholar ] [ CrossRef ]
• Alcázar-Alay, S.C.; Meireles, M.A.A. Physicochemical properties, modifications and applications of starches from different botanical sources. Food Sci. Technol. 2015 , 35 , 215–236. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Vlad-Oros, B.; Preda, G.; Dudas, Z.; Dragomirescu, M.; Chiriac, A. Entrapment of glucoamylase by sol-gel technique in PhTES/TEOS hybrid matrixes. Process. Appl. Ceram. 2007 , 1 , 63–67. [ Google Scholar ] [ CrossRef ]
• Peng, X. Advanced Characterization of Glucan Particulates: Small-Granule Starches, Retention of Small Molecules and Local … no. December. 2018. Available online: http://pstorage-purdue-258596361474.s3.amazonaws.com/13701095/XingyunPengsDissertation_1201182.pdf (accessed on 1 September 2021).
• Cornejo, F.; Rosell, C.M. Physicochemical properties of long rice grain varieties in relation to gluten free bread quality. LWT-Food Sci. Technol. 2015 , 62 , 1203–1210. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Uraipong, C. Investigation into the Biological Functions of Rice Bran Protein Hydrolysates. Ph.D. Thesis, The University of New South Wales, Sydney, NSW, Australia, 2016; pp. 1–219. [ Google Scholar ]
• Pedrazzini, E.; Mainieri, D.; Marrano, C.A.; Vitale, A. Where do protein bodies of cereal seeds come from? Front. Plant Sci. 2016 , 7 , 1139. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Roustan, V.; Hilscher, J.; Weidinger, M.; Reipert, S.; Shabrangy, A.; Gebert, C.; Dietrich, B.; Dermendjiev, G.; Schnurer, M.; Roustan, P.-J.; et al. Protein sorting into protein bodies during barley endosperm development is putatively regulated by cytoskeleton members, MVBs and the HvSNF7s. Sci. Rep. 2020 , 10 , 1864. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Mohd Fairulnizal, M.N.; Norhayati, M.K.; Zaiton, A.; Norliza, A.H.; Rusidah, S.; Aswir, A.R.; Suraiami, M.; Mohd Naeem, M.N.; Jo-Lyn, A.; Mohd Azerulazree, J.; et al. Nutrient content in selected commercial rice in Malaysia: An update of Malaysian food composition database. Int. Food Res. J. 2015 , 22 , 768–776. [ Google Scholar ]
• Masumura, T.; Shigemitsu, T.; Morita, S.; Satoh, S. Identification of the region of rice 13 KDa prolamin essential for the formation of ER-derived protein bodies using a heterologous expression system. Biosci. Biotechnol. Biochem. 2015 , 79 , 566–573. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Saito, Y.; Shigemitsu, T.; Yamasaki, R.; Sasou, A.; Goto, F.; Kishida, K.; Kuroda, M.; Tanaka, K.; Morita, S.; Satoh, S.; et al. Formation mechanism of the internal structure of type I protein bodies in rice endosperm: Relationship between the localization of prolamin species and the expression of individual genes. Plant J. 2012 , 70 , 1043–1055. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Kang, M.-Y.; Kim, J.-H.; Rico, C.-W.; Nam, S.-H. A comparative study on the physicochemical characteristics of black rice varieties. Int. J. Food Prop. 2011 , 14 , 1241–1254. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Yoon, M.R.; Rico, C.W.; Koh, H.J.; Kang, M.Y. A study on the lipid components of rice in relation to palatability and storage. J. Korean Soc. Appl. Biol. Chem. 2012 , 55 , 515–521. [ Google Scholar ] [ CrossRef ]
• Zhang, X.; Yi, S.; Ning, Z.; Jinsong, B.; Wu, D.; Xiaoli, S. The effects of internal endosperm lipids on starch properties: Evidence from rice mutant starches. J. Cereal Sci. 2019 , 89 , 102804. [ Google Scholar ] [ CrossRef ]
• Lu, H.; Jiang, H.; Chen, Q. Determination of fatty acid content of rice during storage based on feature fusion of olfactory visualization sensor data and near-infrared spectra. Sensors 2021 , 21 , 3266. [ Google Scholar ] [ CrossRef ]
• Orsavova, J.; Misurcova, L.; Ambrozova, J.V.; Vicha, R.; Mlcek, J. Fatty acids composition of vegetable oils and its contribution to dietary energy intake and dependence of cardiovascular mortality on dietary intake of fatty acids. Int. J. Mol. Sci. 2015 , 16 , 12871–12890. [ Google Scholar ] [ CrossRef ]
• Devi, A.; Khatkar, B.S. Effects of fatty acids composition and microstructure properties of fats and oils on textural properties of dough and cookie quality. J. Food Sci. Technol. 2018 , 55 , 321–330. [ Google Scholar ] [ CrossRef ]
• Mohamed, I.O. Effects of processing and additives on starch physicochemical and digestibility properties. Carbohydr. Polym. Technol. Appl. 2021 , 2 , 100039. [ Google Scholar ] [ CrossRef ]
• Bao, J. Rice Starch ; Elsevier Inc. in Cooperation with AACC International: Amsterdam, The Netherlands, 2018. [ Google Scholar ] [ CrossRef ]
• Wattanavanitchakorn, S.; Wansuksri, R.; Chaichoompu, E. Biochemical and molecular assessment of cooking quality and nutritional value of pigmented and non-pigmented whole grain rice. Preprints 2021 . [ Google Scholar ] [ CrossRef ]
• Chawla, R.; Patil, G.R. Fiber. Compr. Rev. Food Sci. Food Safe 2010 , 9 , 178–196. [ Google Scholar ] [ CrossRef ]
• Sethy, K.; Mishra, S.K.; Mohanty, P.P.; Agarawal, J.; Meher, P.; Satapathy, D.; Sahoo, J.K.; Panda, S.; Nayak, S.M. An overview of Non Starch Polysaccharide. J. Anim. Nutr. Physiol. 2015 , 1 , 17–22. [ Google Scholar ]
• Sinha, A.K.; Kumar, V.; Makkar, H.P.S.; de Boeck, G.; Becker, K. Non-starch polysaccharides and their role in fish nutrition—A review. Food Chem. 2011 , 127 , 1409–1426. [ Google Scholar ] [ CrossRef ]
• Hartini, S.; Choct, M. The effects of diets containing different level of non-starch polysaccharides on performance and cannibalism in laying hens. J. Indones. Trop. Anim. Agric. 2010 , 35 , 145–150. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Harholt, J.; Suttangkakul, A.; Scheller, H.V. Biosynthesis of pectin. Plant Physiol. 2010 , 153 , 384–395. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• van Dam, J.E.G.; van den Broek, L.A.M.; Boeriu, C.G. Polysaccharides in human health care. Nat. Prod. Commun. 2017 , 12 , 821–830. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• WCRF/AICR. Recommendations and public health and policy implications. In Continous Update Project ; WCRF/AICR: London, UK, 2018. [ Google Scholar ]
• Uthumporn, U.; Nadiah, I.; Izzuddin, I.; Cheng, L.H.; Aida, H. Physicochemical characteristics of non-starch polysaccharides extracted from cassava tubers. Sains Malays. 2017 , 46 , 223–229. [ Google Scholar ] [ CrossRef ]
• Krishnanunni, K.; Senthilvel, P.; Ramaiah, S.; Anbarasu, A. Study of chemical composition and volatile compounds along with in-vitro assay of antioxidant activity of two medicinal rice varieties: Karungkuravai and Mappilai samba. J. Food Sci. Technol. 2015 , 52 , 2572–2584. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Ashokkumar, K.; Govindaraj, M.; Vellaikumar, S.; Shobhana, V.G.; Karthikeyan, A.; Akilan, M.; Sathishkumar, J. Comparative Profiling of Volatile Compounds in Popular South Indian Traditional and Modern Rice Varieties by Gas Chromatography–Mass Spectrometry Analysis. Front. Nutr. 2020 , 7 , 260. [ Google Scholar ] [ CrossRef ]
• Cory, H.; Passarelli, S.; Szeto, J.; Tamez, M.; Mattei, J. The Role of Polyphenols in Human Health and Food Systems: A Mini-Review. Front. Nutr. 2018 , 5 , 87. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Altemimi, A.; Lakhssassi, N.; Baharlouei, A.; Watson, D.G.; Lightfoot, D.A. Phytochemicals: Extraction, isolation, and identification of bioactive compounds from plant extracts. Plants 2017 , 6 , 42. [ Google Scholar ] [ CrossRef ]
• Ciulu, M.; de la Luz Cádiz-Gurrea, M.; Segura-Carretero, A. Extraction and analysis of phenolic compounds in rice: A review. Molecules 2018 , 23 , 2890. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Shao, Y.; Hu, Z.; Yu, Y.; Mou, R.; Zhu, Z.; Beta, T. Phenolic acids, anthocyanins, proanthocyanidins, antioxidant activity, minerals and their correlations in non-pigmented, red, and black rice. Food Chem. 2018 , 239 , 733–741. [ Google Scholar ] [ CrossRef ]
• Wisetkomolmat, J.; Arjin, C.; Satsook, A.; Seel-Audom, M.; Ruksiriwanich, W.; Prom-u-Thai, C.; Sringarm, K. Comparative Analysis of Nutritional Components and Phytochemical Attributes of Selected Thai Rice Bran. Front. Nutr. 2022 , 9 , 833730. [ Google Scholar ] [ CrossRef ]
• Podgórska, A.; Burian, M.; Gieczewska, K. Altered Cell Wall Plasticity Can Restrict Plant Growth under Ammonium Nutrition. Front. Plant Sci. 2017 , 8 , 1344. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Speranza, S.; Knechtl, R.; Witlaczil, R.; Schönlechner, R. Reversed-Phase HPLC Characterization and Quantification and Antioxidant Capacity of the Phenolic Acids and Flavonoids Extracted from Eight Varieties of Sorghum Grown in Austria. Front. Plant Sci. 2021 , 12 , 769151. [ Google Scholar ] [ CrossRef ]
• Singla, R.K.; Dubey, A.K.; Garg, A.; Sharma, R.K.; Fiorino, M.; Ameen, S.M.; Haddad, M.A.; Al-Hiary, M. Natural Polyphenols: Chemical Classification, Definition of Classes, Subcategories, and Structures. J. AOAC Int. 2019 , 102 , 1397–1400. [ Google Scholar ] [ CrossRef ]
• Kumar, N.; Goel, N. Phenolic acids: Natural versatile molecules with promising therapeutic applications. Biotechnol. Rep. 2019 , 24 , e00370. [ Google Scholar ] [ CrossRef ]
• Ansari, M.-U.-R. Recent Advances in Rice Research ; IntechOpen: London, UK, 2021. [ Google Scholar ] [ CrossRef ]
• Bhat, F.M.; Sommano, S.R.; Riar, C.S.; Seesuriyachan, P.; Chaiyaso, T.; Prom-U-thai, C. Status of bioactive compounds from bran of pigmented traditional rice varieties and their scope in production of medicinal food with nutraceutical importance. Agronomy 2020 , 10 , 1817. [ Google Scholar ] [ CrossRef ]
• Huang, Y.P.; Lai, H.M. Bioactive compounds and antioxidative activity of colored rice bran. J. Food Drug Anal. 2016 , 24 , 564–574. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Verma, D.K.; Srivastav, P.P. Bioactive compounds of rice ( Oryza sativa L.): Review on paradigm and its potential benefit in human health. Trends Food Sci. Technol. 2020 , 97 , 355–365. [ Google Scholar ] [ CrossRef ]
• Rauf, A.; Imran, M.; Abu-izneid, T.; Patel, S. Proanthocyanidins: A comprehensive review. Biomed. Pharmacother. 2019 , 116 , 108999. [ Google Scholar ] [ CrossRef ]
• Gunaratne, A.; Wu, K.; Li, D.; Bentota, A.; Corke, H.; Cai, Y.Z. Antioxidant activity and nutritional quality of traditional red-grained rice varieties containing proanthocyanidins. Food Chem. 2013 , 138 , 1153–1161. [ Google Scholar ] [ CrossRef ]
• Panche, A.N.; Diwan, A.D.; Chandra, S.R. Flavonoids: An overview. J. Nutr. Sci. 2016 , 5 , e47. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Khoo, H.E. Anthocyanidins and anthocyanins: Colored pigments as food, pharmaceutical ingredients, and the potential health benefits. Food Nutr. Res. 2017 , 61 , 1361779. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Daiponmak, W.; Theerakulpisut, P.; Thanonkeo, P.; Vanavichit, A. Changes of anthocyanin cyanidin-3-glucoside content and antioxidant activity in Thai rice varieties under salinity stress. Sci. Asia 2010 , 36 , 286–291. [ Google Scholar ] [ CrossRef ]
• Bharti, S.; Anand, S. Fragrance and Aroma in Rice. Food Sci. Rep. 2020 , 1 . [ Google Scholar ] [ CrossRef ]
• Hinge, V.R.; Patil, H.B.; Nadaf, A.B. Aroma volatile analyses and 2AP characterization at various developmental stages in Basmati and Non-Basmati scented rice ( Oryza sativa L.) cultivars. Rice 2016 , 9 , 38. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Verma, S.; Srivastava, S.; Tiwari, N. Comparative study on nutritional and sensory quality of barnyard and foxtail millet food products with traditional rice products. J. Food Sci. Technol. 2015 , 52 , 5147–5155. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Yin, W.; Hewson, L.; Linforth, R.; Taylor, M.; Fisk, I.D. Effects of aroma and taste, independently or in combination, on appetite sensation and subsequent food intake. Appetite 2017 , 114 , 265–274. [ Google Scholar ] [ CrossRef ]
• Liyanaarachchi, G.D.; Kottearachchi, N.S.; Samarasekera, R. Volatile profiles of traditional aromatic rice varieties in Sri Lanka. J. Natl. Sci. Found. Sri Lanka 2014 , 42 , 87–93. [ Google Scholar ] [ CrossRef ]
• Ramtekey, V.; Cherukuri, S.; Modha, K.G.; Kumar, A.; Kethineni, U.B.; Pal, G.; Singh, A.N.; Kumar, S. Extraction, characterization, quantification, and application of volatile aromatic compounds from Asian rice cultivars. Rev. Anal. Chem. 2021 , 40 , 272–292. [ Google Scholar ] [ CrossRef ]
• Kasote, D.; Singh, V.K.; Bollinedi, H.; Singh, A.K.; Sreenivasulu, N. Profiling of 2-Acetyl-1-Pyrroline and Other Volatile Compounds in Raw and Cooked Rice of Traditional and Improved Varieties. Foods 2021 , 10 , 1917. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Liu, H.; Hui, T.; Fang, F.; Ma, Q.; Li, S.; Zhang, D. Characterization and Discrimination of Key Aroma Compounds in Pre- and Postrigor Roasted Mutton by GC-O-MS, GC E-Nose and Aroma Recombination Experiments. Foods 2021 , 10 , 2387. [ Google Scholar ] [ CrossRef ]
• Müller-Wirtz, L.M.; Kiefer, D.; Ruffing, S.; Brausch, T.; Hüppe, T.; Sessler, D.I.; Volk, T.; Fink, T.; Kreuer, S.; Maurer, F. Quantification of Volatile Aldehydes Deriving from In Vitro Lipid Peroxidation in the Breath of Ventilated Patients. Molecules 2021 , 26 , 3089. [ Google Scholar ] [ CrossRef ]
• Lin, J.-Y.; Fan, W.; Gao, Y.-N.; Wu, S.-F.; Wang, S.-X. Study on volatile compounds in rice by HS-SPME and GC-MS. In Proceedings of the 10th International Working Conference on Stored Product Protection, Estoril, Portugal, 27 June–2 July 2010; pp. 125–134. [ Google Scholar ] [ CrossRef ]
• Rasane, P.; Jha, A.; Sabikhi, L.; Kumar, A.; Unnikrishnan, V.S. Nutritional advantages of oats and opportunities for its processing as value added foods—A review. J. Food Sci. Technol. 2015 , 52 , 662–675. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Carcea, M. Value of wholegrain rice in a healthy human nutrition. Agriculture 2021 , 11 , 720. [ Google Scholar ] [ CrossRef ]
• Kapoor, B.; Kapoor, D.; Gautam, S.; Singh, R.; Bhardwaj, S. Dietary Polyunsaturated Fatty Acids (PUFAs): Uses and Potential Health Benefits. Curr. Nutr. Rep. 2021 , 10 , 232–242. [ Google Scholar ] [ CrossRef ]
• Nguyen, H.D.; Jo, W.H.; Hong, N.; Hoang, M.; Kim, M. International Immunopharmacology Anti-inflammatory effects of B vitamins protect against tau hyperphosphorylation and cognitive impairment induced by 1, 2 diacetyl benzene: An in vitro and in silico study. Int. Immunopharmacol. 2022 , 108 , 108736. [ Google Scholar ] [ CrossRef ]
• Lattimer, J.M.; Haub, M.D. Effects of dietary fiber and its components on metabolic health. Nutrients 2010 , 2 , 1266–1289. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Ma, Z.-Q.; Yi, C.-P.; Wu, N.-N.; Ban, T. Reduction of phenolic profiles, dietary fiber, and antioxidant activities of rice after treatment with different milling processes. Cereal Chem. 2020 , 97 , 1158–1171. [ Google Scholar ] [ CrossRef ]
• Paul, H.; Nath, B.C.; Bhuiyan, M.G.K.; Paul, S. Effect of Degree of Milling on Rice Grain Quality. J. Agric. Eng. 2020 , 42 , 69–76. [ Google Scholar ]
• Kim, S.H.; Yang, Y.J.; Chung, I.M. The effect of degree of milling on the nutraceutical content in ecofriendly and conventional rice ( Oryza sativa L.). Foods 2020 , 9 , 1297. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Li, F.; Guan, X.; Li, C. Effects of degree of milling on the starch digestibility of cooked rice during (in vitro) small intestine digestion. Int. J. Biol. Macromol. 2021 , 188 , 774–782. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• van der Kamp, J.W.; Poutanen, K.; Seal, C.J.; Richardson, D.P. The HEALTHGRAIN definition of ‘whole grain’. Food Nutr. Res. 2014 , 58 , 1–8. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Develaraja, S.; Reddy, A.; Yadav, M.; Jain, S.; Yadav, H. Whole Grains in Amelioration of Metabolic Derangements. J. Nutr. Health Food Sci. 2016 , 4 , 1–11. [ Google Scholar ]
• Hollænder, P.L.B.; Ross, A.B.; Kristensen, M. Whole-grain and blood lipid changes in apparently healthy adults: A systematic review and meta-analysis of randomized controlled studies1-3. Am. J. Clin. Nutr. 2015 , 102 , 556–572. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Aune, D.; Keum, N.; Giovannucci, E.; Fadnes, L.T.; Boffetta, P.; Greenwood, D.C.; Tonstad, S.; Vatten, L.J.; Riboli, E.; Norat, T. Whole grain consumption and risk of cardiovascular disease, cancer, and all cause and cause specific mortality: Systematic review and dose-response meta-analysis of prospective studies. BMJ 2016 , 353 , i2716. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Nokkoul, R. Organic upland rice seed production. Adv. J. Food Sci. Technol. 2014 , 6 , 1313–1317. [ Google Scholar ] [ CrossRef ]
• Gul, K.; Yousuf, B.; Singh, A.K.; Singh, P.; Wani, A.A. Rice bran: Nutritional values and its emerging potential for development of functional food—A review. Bioact. Carbohydr. Diet. Fibre 2015 , 6 , 24–30. [ Google Scholar ] [ CrossRef ]
• Kumar, A.; Priyadarshinee, R.; Roy, A.; Dasgupta, D.; Mandal, T. Current techniques in rice mill effluent treatment: Emerging opportunities for waste reuse and waste-to-energy conversion. Chemosphere 2016 , 164 , 404–412. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Olayanju, A.T.; Okonkwo, C.E.; Ojediran, J.O.; Hussain, S.Z.; Dottie, E.P.; Ayoola, A.S. Interactive effects and modeling of some processing parameters on milling, cooking, and sensory properties for Nigerian rice using a one-step rice milling machine. Heliyon 2021 , 7 , e06739. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Bodie, A.R.; Micciche, A.C.; Atungulu, G.G.; Rothrock, M.J.; Ricke, S.C. Current Trends of Rice Milling Byproducts for Agricultural Applications and Alternative Food Production Systems. Front. Sustain. Food Syst. 2019 , 3 , 47. [ Google Scholar ] [ CrossRef ]
• Manandhar, A.; Milindi, P.; Shah, A. An overview of the post-harvest grain storage practices of smallholder farmers in developing countries. Agriculture 2018 , 8 , 57. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Mobolade, A.J.; Bunindro, N.; Sahoo, D.; Rajashekar, Y. Traditional methods of food grains preservation and storage in Nigeria and India. Ann. Agric. Sci. 2019 , 64 , 196–205. [ Google Scholar ] [ CrossRef ]
• Baributsa, D.; Ignacio, M.C.C. Developments in the Use of Hermetic Bags for Grain Storage ; Burleigh Dodds Science Publishing: Cambridge, UK, 2020; pp. 171–198. [ Google Scholar ] [ CrossRef ]
• Covele, G.; Gulube, A.; Tivana, L.; Ribeiro-Barros, A.I.; Carvalho, M.O.; Ndayiragije, A.; Nguenha, R. Effectiveness of hermetic containers in controlling paddy rice ( Oryza sativa L.) storage insect pests. J. Stored Prod. Res. 2020 , 89 , 101710. [ Google Scholar ] [ CrossRef ]
• Hossain, M.A.; Awal, A.; Alam, M.; Ali, R.; Azmal, F. Do Hermetic Storage Technology Significantly Abate Losses of Rice over Time? An Economic Evaluation. Int. J. Manag. Account. 2021 , 3 , 52–59. [ Google Scholar ] [ CrossRef ]
• Lane, B.; Woloshuk, C. Impact of storage environment on the efficacy of hermetic storage bags. J. Stored Prod. Res. 2017 , 72 , 83–89. [ Google Scholar ] [ CrossRef ]
• Awal, M.A.; Ali, M.R.; Hossain, M.A.; Alam, M.M.; Kalita, P.K.; Harvey, J. Hermetic bag an effective and economic rice storage technology in Bangladesh. In Proceedings of the 2017 ASABE Annual International Meeting, Washington, DC, USA, 16–19 July 2017; pp. 1–10. [ Google Scholar ] [ CrossRef ]
• Baributsa, D.; Baoua, I.B.; Bakoye, O.N.; Amadou, L.; Murdock, L.L. PICS bags safely store unshelled and shelled groundnuts in Niger. J. Stored Prod. Res. 2017 , 72 , 54–58. [ Google Scholar ] [ CrossRef ]
• Kanta, R.A. Paddy Quality during Storage in Different Storage Technologies. Master Thesis, Bangladesh Agricultural University, Mymensingh, Bangladesh, 2016. [ Google Scholar ]
• Prasetyo, T.; Riska, L.; Arlanta, R.; Sumardiono, S. Experimental Study of Paddy Grain Drying in Continuous Recirculation System Pneumatic Conveyor. MATEC Web Conf. 2018 , 156 , 05022. [ Google Scholar ] [ CrossRef ]
• Sahari, Y.; Wahid, R.A.; Mhd Adnan, A.S.; Sairi, M.; Hosni, H.; Engku Abdullah, E.H.; Alwi, S.; Mohd Amin Tawakkal, M.H.; Zainol Abidin, M.Z.; Aris, Z. Study on the drying performance and milling quality of dried paddy using inclined bed dryers in two different paddy mills located in MADA and IADA KETARA. Int. Food Res. J. 2018 , 25 , 2572–2578. [ Google Scholar ]
• Nwilene, F.E.; Oikeh, S.O.; Agunbiade, T.A.; Oladimeji, O.; Ajayi, O.; Sié, M.; Gregorio, G.B.; Togola, A.; Touré, A.D. Growing Lowland Rice: A Production Handbook ; Africe Rice Center (WARDA) E-Publishing: Cotonou, Benin, 2011. [ Google Scholar ]
• Romuli, S.; Schock, S.; Somda, M.K.; Müller, J. Drying performance and aflatoxin content of paddy rice applying an inflatable solar dryer in Burkina Faso. Appl. Sci. 2020 , 10 , 3533. [ Google Scholar ] [ CrossRef ]
• Salvatierra-Rojas, A.; Nagle, M.; Gummert, M.; de Bruin, T.; Müller, J. Development of an inflatable solar dryer for improved postharvest handling of paddy rice in humid climates. Int. J. Agric. Biol. Eng. 2017 , 10 , 269–282. [ Google Scholar ] [ CrossRef ]
• Wang, T.; Khir, R.; Pan, Z.; Yuan, Q. Simultaneous rough rice drying and rice bran stabilization using infrared radiation heating. LWT-Food Sci. Technol. 2017 , 78 , 281–288. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Dibagar, N.; Chayjan, R.A.; Kowalski, S.J.; Peyman, S.H. Deep bed rough rice air-drying assisted with airborne ultrasound set at 21 kHz frequency: A physicochemical investigation and optimization. Ultrason. Sonochem. 2019 , 53 , 25–43. [ Google Scholar ] [ CrossRef ]
• Jittanit, W.; Srzednicki, G.; Driscoll, R.H. Comparison between Fluidized Bed and Spouted Bed Drying for Seeds. Dry. Technol. 2013 , 31 , 52–56. [ Google Scholar ] [ CrossRef ]
• Tumpanuvatr, T.; Jittanit, W.; Surojanametakul, V. Effects of drying conditions in hybrid dryer on the GABA rice properties. J. Stored Prod. Res. 2018 , 77 , 177–188. [ Google Scholar ] [ CrossRef ]
• Mutungi, C.; Gaspar, A.; Abass, A. Postharvest Operations and Quality Specifications for Rice: A Trainer’s Manual for Smallholder Farmers in Tanzania ; IITA: Ibadan, Nigeria, 2020. [ Google Scholar ]
• Sims, R.; Flammini, A.; Puri, M.; Bracco, S. Opportunities for Agri-Food Chains to Become Energy-Smart ; FAO: Rome, Italy, 2016; Volume 43. [ Google Scholar ]
• Kahandage, P.D.; Weerasooriya, G.V.T.V.; Ranasinghe, V.P.; Kosgollegedara, E.J.; Piyathissa, S.D.S. Design, Development and Performance Evaluation of a Seed Paddy Cleaning Machine. Sri Lankan J. Agric. Ecosyst. 2021 , 3 , 41. [ Google Scholar ] [ CrossRef ]
• Adetola, O.A.; Akindahunsi, D.L. A Review on Performance of Rice De-stoning Machines. J. Eng. Res. Rep. 2020 , 1–11. [ Google Scholar ] [ CrossRef ]
• Baker, A.; Dwyer-Joyce, R.S.; Briggs, C.; Brockfeld, M. Effect of different rubber materials on husking dynamics of paddy rice. Proc. Inst. Mech. Eng. Part J J. Eng. Tribol. 2012 , 226 , 516–528. [ Google Scholar ] [ CrossRef ]
• Dhankhar, P. Rice Milling. IOSR J. Eng. 2014 , 4 , 34–42. [ Google Scholar ] [ CrossRef ]
• Manickavasagan, A.; Chandini, S.K.; Venkatachalapathy, N. Brown Rice ; Springer: Berlin, Germany, 2017; pp. 1–290. [ Google Scholar ] [ CrossRef ]
• Fouda, T. Study on the whitening characteristics of some laboratory rice milling machines. In Proceedings of the 13th Annual Conference Misr Society Agr. Eng., Cairo, Egypt, 14–15 December 2005; Volume 195, pp. 192–205. Available online: https://www.researchgate.net/publication/277814862%0AStudy (accessed on 1 September 2021).
• Das, M.; Gupta, S.; Kapoor, V.; Banerjee, R.; Bal, S. Enzymatic polishing of rice—A new processing technology. LWT-Food Sci. Technol. 2008 , 41 , 2079–2084. [ Google Scholar ] [ CrossRef ]
• Xu, Z.; Xu, Y.; Zhang, L.; Li, H.; Sui, Z.; Corkede, H. Polishing conditions in rice milling differentially affect the physicochemical properties of waxy, low- and high-amylose rice starch. J. Cereal Sci. 2021 , 99 , 103183. [ Google Scholar ] [ CrossRef ]
• Custodio, M.C.; Cuevas, R.P.; Ynion, J.; Laborte, A.G.; Velasco, M.L.; Demont, M. Rice quality: How is it defined by consumers, industry, food scientists, and geneticists? Trends Food Sci. Technol. 2019 , 92 , 122–137. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Chepa, N.; Yusoff, N.; Ahmad, N. Designing a Neural Network Model in Grading Malaysian Rice. Int. J. Eng. Technol. 2018 , 7 , 790–793. [ Google Scholar ]
• Ghatkamble, R. Grading and Classification of Rice Grain Using PNN Technique in Digital Image Processing. Int. J. Comput. Sci. Trends Technol. 2013 , 6 , 59–63. [ Google Scholar ]
• Temniranrat, P.; Sinthupinyo, W.; Prempree, P.; Chaitavon, K.; Porntheeraphat, S.; Prasertsak, A. Development of Paddy Rice Seed Classification Process using Machine Learning Techniques for Automatic Grading Machine. J. Sens. 2020 , 2020 , 7041310. [ Google Scholar ] [ CrossRef ]
• Tanck, P.; Kaushal, B. A New Technique of Quality Analysis for Rice Grading for Agmark Standards. Int. J. Innov. Technol. Explor. Eng. 2014 , 3 , 83–85. [ Google Scholar ]
• Ibrahim, S.; Zulkifli, N.A.; Sabri, N.; Shari, A.A.; Noordin, M.R.M. Rice grain classification using multi-class support vector machine (SVM). IAES Int. J. Artif. Intell. 2019 , 8 , 215–220. [ Google Scholar ] [ CrossRef ]
• Chepa, N.; Yusoff, N.; Ahmad, N. Exploring the determinants for grading malaysian rice. Int. J. Innov. Technol. Explor. Eng. 2019 , 8 , 199–203. [ Google Scholar ]
• Shiddiq, D.M.F.; Nazaruddin, Y.Y.; Muchtadi, F.I.; Raharja, S. Estimation of rice milling degree using image processing and Adaptive Network Based Fuzzy Inference System (ANFIS). In Proceedings of the 2011 2nd International Conference on Instrumentation Control and Automation, Bandung, Indonesia, 15–17 November 2011; pp. 98–103. [ Google Scholar ] [ CrossRef ]
• Liu, W.; Huang, Y.; Ye, Z.; Cai, W.; Yang, S.; Cheng, X.; Frank, I. Renyi’s entropy based multilevel thresholding using a novel meta-heuristics algorithm. Appl. Sci. 2020 , 10 , 3225. [ Google Scholar ] [ CrossRef ]
• Yao, Y.; Wu, W.; Yang, T.; Liu, T.; Chen, W.; Chen, C.; Li, R.; Zhou, T.; Sun, C.; Zhou, Y.; et al. Head rice rate measurement based on concave point matching. Sci. Rep. 2017 , 7 , 41353. [ Google Scholar ] [ CrossRef ] [ PubMed ] [ Green Version ]
• Silva, C.S.; Sonnadara, U. Classification of Rice Grains Using Neural Networks. Proc. Tech. Sess. 2013 , 29 , 9–14. [ Google Scholar ]
• FAOSTAT. Emissions Totals. 2021. Available online: https://www.fao.org/faostat/en/#data/GT/visualize (accessed on 1 September 2021).
• Wichelns, D. Managing water and soils to achieve adaptation and reduce methane emissions and arsenic contamination in Asian rice production. Water 2016 , 8 , 141. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Qin, X.; Li, Y.E.; Wang, H.; Li, J.; Wan, Y.; Gao, Q.; Liao, Y.; Fan, M. Effect of rice cultivars on yield-scaled methane emissions in a double rice field in South China. J. Integr. Environ. Sci. 2015 , 12 , 47–66. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Martínez-Eixarch, M.; Alcaraz, C.; Viñas, M.; Noguerol, J.; Aranda, X.; Prenafeta-Boldú, F.X.; Català-Forner, M.; Fennessy, M.S.; Ibáñez, C. The main drivers of methane emissions differ in the growing and flooded fallow seasons in Mediterranean rice fields. Plant Soil 2021 , 460 , 211–227. [ Google Scholar ] [ CrossRef ]
• Jiang, Y.; Zhang, H.; He, J.; Huan, P. Study on Methane Emission Factor of Paddy Fields in Hubei Province. IOP Conf. Ser. Earth Environ. Sci. 2021 , 651 , 042031. [ Google Scholar ] [ CrossRef ]
• Sass, R. CH 4 emissions from rice agriculture. In Good Practice Guidance and Uncertainty Management in National Greenhouse Gas Inventories ; Institute for Global Environmental Strategies (IGES): Hayama, Japan, 2003; pp. 399–417. [ Google Scholar ]
• Prangbang, P.; Yagi, K.; Aunario, J.K.S.; Sander, B.O.; Wassmann, R.; Jäkel, T.; Buddaboon, C.; Chidthaisong, A.; Towprayoon, S. Climate-Based Suitability Assessment for Methane Mitigation by Water Saving Technology in Paddy Fields of the Central Plain of Thailand. Front. Sustain. Food Syst. 2020 , 4 , 575823. [ Google Scholar ] [ CrossRef ]
• Epule, E.T.; Peng, C.; Mafany, N.M. Methane Emissions from Paddy Rice Fields: Strategies towards Achieving a Win-Win Sustainability Scenario between Rice Production and Methane Emission Reduction. J. Sustain. Dev. 2011 , 4 . [ Google Scholar ] [ CrossRef ]
• Koizumi, T.; Hubertus, S.; Furuhashi, G. Reviewing Indica and Japonica Rice Market Developments. OECD Publications. 2021. Available online: https://www.oecd.org/publications/reviewing-indica-and-japonica-rice-market-developments-0c500e05-en.htm (accessed on 1 October 2021).
• Firdaus, R.B.R.; Tan, M.L.; Rahmat, S.R.; Gunaratne, M.S. Paddy, rice and food security in Malaysia: A review of climate change impacts. Cogent Soc. Sci. 2020 , 6 , 1818373. [ Google Scholar ] [ CrossRef ]
• Alam, M.M.; Siwar, C.; Murad, M.W.; Toriman, M.E. Impacts of climate change on agriculture and food security issues in Malaysia: An empirical study on farm level assessment. World Appl. Sci. J. 2011 , 14 , 431–442. [ Google Scholar ]
• Müller, C.; Elliott, J.; Chryssanthacopoulos, J.; Deryng, D.; Folberth, C.; Pugh, T.A.M.; Schmid, E. Implications of climate mitigation for future agricultural production. Environ. Res. Lett. 2015 , 10 , 125004. [ Google Scholar ] [ CrossRef ]
• Nawaz, A.; Shafi, T.; Khaliq, A.; Mukhtar, H.; ul Haq, I. Tyrosinase: Sources, Structure and Applications. Int. J. Biotechnol. Bioeng. 2017 , 3 , 135–141. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Lin, H.; Yu, Y.; Wen, F.; Liu, P. Status of Food Security in East and Southeast Asia and Challenges of Climate Change. Climate 2022 , 10 , 40. [ Google Scholar ] [ CrossRef ]
• Wang, L.; Guo, Y.; Zhu, Y.; Li, Y.; Qu, Y.; Rong, C.; Ma, X.; Wang, Z. A new route for preparation of hydrochars from rice husk. Bioresour. Technol. 2010 , 101 , 9807–9810. [ Google Scholar ] [ CrossRef ]
• Mohanta, K.; Kumar, D.; Parkash, O. Properties and Industrial Applications of Rice husk: A review. Int. J. Emerg. Technol. Adv. Eng. 2012 , 2 , 86–90. [ Google Scholar ]
• Soltani, N.; Bahrami, A.; Pech-Canul, M.I.; González, L.A. Review on the physicochemical treatments of rice husk for production of advanced materials. Chem. Eng. J. 2015 , 264 , 899–935. [ Google Scholar ] [ CrossRef ]
• Bakar, R.A.; Yahya, R.; Gan, S.N. Production of High Purity Amorphous Silica from Rice Husk. Procedia Chem. 2016 , 19 , 189–195. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Zawawi, W.N.I.W.M.; Mansor, A.F.; Othman, N.S.; Mohidem, N.A.; Malek, N.A.N.N.; Mat, H. Synthesis and characterization of immobilized white-rot fungus Trametes versicolor in sol–gel ceramics. J. Sol-Gel Sci. Technol. 2016 , 77 , 28–38. [ Google Scholar ] [ CrossRef ]
• Suleman, M.; Zafar, M.; Ahmed, A.; Rashid, M.U.; Hussain, S.; Razzaq, A.; Mohidem, N.A.; Fazal, T.; Haider, B.; Park, Y.-K. Castor leaves-based biochar for adsorption of safranin from textile wastewater. Sustainability 2021 , 13 , 6926. [ Google Scholar ] [ CrossRef ]
• Shamsuri, N.A.A.; Mohidem, N.A.; Mansor, A.F.; Mat, H. Biodegradation of Dye Using Free Laccase and Sol-gel Laccase. Jurnal Teknologi 2012 , 59 , 39–42. [ Google Scholar ] [ CrossRef ] [ Green Version ]
• Kumar, A.; Roy, A.; Priyadarshinee, R.; Sengupta, B.; Malaviya, A.; Dasguptamandal, D.; Mandal, T. Economic and sustainable management of wastes from rice industry: Combating the potential threats. Environ. Sci. Pollut. Res. 2017 , 24 , 26279–26296. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• FAO. Crop Prospects and Food Situation—Quarterly Global Report No. 4, December 2020 ; FAO: Rome, Italy, 2020. [ Google Scholar ] [ CrossRef ]
• Teck, T.B.; Shan, F.P.; Firdaus, R.B.R.; Leong, T.M.; Senevi, G.M. Impact of climate change on rice yield in malaysia: A panel data analysis. Agriculture 2021 , 11 , 569. [ Google Scholar ] [ CrossRef ]
• Sulaiman, N.; Yeatman, H.; Russell, J.; Law, L.S. A Food Insecurity Systematic Review: Experience from Malaysia. Nutrients 2021 , 13 , 945. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Kumar, N.; Chhokar, R.S.; Meena, R.; Gill, S.C.; Tripathi, S.C.; Gupta, O.P.; Mangrauthia, S.K.; Sundaram, R.M.; Sawant, C.P.; Gupta, A.; et al. Challenges and opportunities in productivity and sustainability of rice cultivation system: A critical review in Indian perspective. Cereal Res. Commun. 2021 . [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Dhanda, S.; Yadav, A.; Yadav, D.B.; Chauhan, B.S. Emerging Issues and Potential Opportunities in the Rice—Wheat Cropping System of North-Western. Front. Plant Sci. 2022 , 13 , 832683. [ Google Scholar ] [ CrossRef ]
• Sarena, C.O.; Ashraf, S.; Aiysyah, T.S. The Status of the Paddy and Rice Industry in Malaysia. 2019. Available online: http://www.krinstitute.org/assets/contentMS/img/template/editor/20190409_RiceReport_FullReport_Final.pdf (accessed on 1 September 2021).
• FAO. Commodity Policy Developments. 2022. Available online: https://www.fao.org/economic/est/estcommodities/commoditypolicyarchive/en/?groupANDcommodity=rice (accessed on 1 October 2021).

Click here to enlarge figure

Share and Cite

Mohidem, N.A.; Hashim, N.; Shamsudin, R.; Che Man, H. Rice for Food Security: Revisiting Its Production, Diversity, Rice Milling Process and Nutrient Content. Agriculture 2022 , 12 , 741. https://doi.org/10.3390/agriculture12060741

Mohidem NA, Hashim N, Shamsudin R, Che Man H. Rice for Food Security: Revisiting Its Production, Diversity, Rice Milling Process and Nutrient Content. Agriculture . 2022; 12(6):741. https://doi.org/10.3390/agriculture12060741

Mohidem, Nur Atikah, Norhashila Hashim, Rosnah Shamsudin, and Hasfalina Che Man. 2022. "Rice for Food Security: Revisiting Its Production, Diversity, Rice Milling Process and Nutrient Content" Agriculture 12, no. 6: 741. https://doi.org/10.3390/agriculture12060741

Article Metrics

Article access statistics, further information, mdpi initiatives, follow mdpi.

Subscribe to receive issue release notifications and newsletters from MDPI journals

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings
• My Bibliography
• Collections
• Citation manager

Save citation to file

Email citation, add to collections.

• Create a new collection
• Add to an existing collection

Add to My Bibliography

Your saved search, create a file for external citation management software, your rss feed.

• Search in PubMed
• Search in NLM Catalog
• Add to Search

Rice: Importance for Global Nutrition

Affiliations.

• 1 USDA, ARS, Beltsville Human Nutrition Research Center.
• 2 USDA, ARS, Adaptive Cropping Systems Laboratory.
• PMID: 31619630
• DOI: 10.3177/jnsv.65.S2

Rice, a staple food for more than half of the world's population, is grown in >100 countries with 90% of the total global production from Asia. Although there are more than 110,000 cultivated varieties of rice that vary in quality and nutritional content, after post-harvest processing, rice can be categorized as either white or brown. Regional and cultural preferences as well as need for stability during storage and transport are the final determinants of market availability and final consumption. In addition to calories, rice is a good source of magnesium, phosphorus, manganese, selenium, iron, folic acid, thiamin and niacin; but it is low in fiber and fat. Although brown rice is promoted as being "healthier" because of bioactive compounds, including minerals and vitamins not present in white rice after polishing, white rice is more widely consumed than brown. This is for several reasons, including cooking ease, palatability, and shelf life. Polished rice has a higher glycemic load and may impact glucose homeostasis but when combined with other foods, it can be considered part of a "healthy" plate. With the projected increase in the global population, rice will remain a staple. However, it will be important to encourage intake of the whole grain (brown rice) and to identify ways to harness the phytonutrients that are lost during milling. Furthermore, as the world faces environmental challenges, changing demographics and consumer demands, farmers, healthcare providers, food manufacturers and nutritionists must work collaboratively to assure adequate supply, nutritional integrity and sustainability of rice production systems globally.

Keywords: global nutrition; health; rice.

PubMed Disclaimer

Similar articles

• Improving Rice Grain Quality Through Ecotype Breeding for Enhancing Food and Nutritional Security in Asia-Pacific Region. Alam M, Lou G, Abbas W, Osti R, Ahmad A, Bista S, Ahiakpa JK, He Y. Alam M, et al. Rice (N Y). 2024 Aug 5;17(1):47. doi: 10.1186/s12284-024-00725-9. Rice (N Y). 2024. PMID: 39102064 Free PMC article. Review.
• Brown Rice, a Diet Rich in Health Promoting Properties. Lee JS, Sreenivasulu N, Hamilton RS, Kohli A. Lee JS, et al. J Nutr Sci Vitaminol (Tokyo). 2019;65(Supplement):S26-S28. doi: 10.3177/jnsv.65.S26. J Nutr Sci Vitaminol (Tokyo). 2019. PMID: 31619639
• Rice bran: a novel functional ingredient. Sharif MK, Butt MS, Anjum FM, Khan SH. Sharif MK, et al. Crit Rev Food Sci Nutr. 2014;54(6):807-16. doi: 10.1080/10408398.2011.608586. Crit Rev Food Sci Nutr. 2014. PMID: 24345050 Review.
• An overview of global rice production, supply, trade, and consumption. Muthayya S, Sugimoto JD, Montgomery S, Maberly GF. Muthayya S, et al. Ann N Y Acad Sci. 2014 Sep;1324:7-14. doi: 10.1111/nyas.12540. Epub 2014 Sep 15. Ann N Y Acad Sci. 2014. PMID: 25224455 Review.
• Cooking rice in excess water reduces both arsenic and enriched vitamins in the cooked grain. Gray PJ, Conklin SD, Todorov TI, Kasko SM. Gray PJ, et al. Food Addit Contam Part A Chem Anal Control Expo Risk Assess. 2016;33(1):78-85. doi: 10.1080/19440049.2015.1103906. Epub 2015 Nov 2. Food Addit Contam Part A Chem Anal Control Expo Risk Assess. 2016. PMID: 26515534
• Target prediction of potential candidate miRNAs from Oryza sativa to silence the Pyricularia oryzae genome in rice blast. Suddal T, Awan MF, Ali S, Sarwar MF, Iqbal S, Ali Q, Javed MA, Alshahrani MY. Suddal T, et al. Sci Rep. 2024 Sep 18;14(1):21813. doi: 10.1038/s41598-024-72608-4. Sci Rep. 2024. PMID: 39294226 Free PMC article.
• Plant growth-promoting rhizobacterium Bacillus megaterium modulates the expression of antioxidant-related and drought-responsive genes to protect rice ( Oryza sativa L.) from drought. Lee S, Kim JA, Song J, Choe S, Jang G, Kim Y. Lee S, et al. Front Microbiol. 2024 Aug 21;15:1430546. doi: 10.3389/fmicb.2024.1430546. eCollection 2024. Front Microbiol. 2024. PMID: 39234545 Free PMC article.
• Estimation of Proximate Composition in Rice Using ATR-FTIR Spectroscopy and Chemometrics. Siregar S, Nurhikmat A, Amdani RZ, Hatmi RU, Kobarsih M, Kusumaningrum A, Karim MA, Dameswari AH, Siswanto N, Siswoprayogi S, Yuliyanto P. Siregar S, et al. ACS Omega. 2024 Jul 16;9(30):32760-32768. doi: 10.1021/acsomega.4c02816. eCollection 2024 Jul 30. ACS Omega. 2024. PMID: 39100304 Free PMC article.
• Enhancing aromatic rice production through agronomic and nutritional management for improved yield and quality. Patra PS, Saha R, Ahmed AS, Kanjilal B, Debnath MK, Paramanik B, Hoque A, Kundu A, Adhikary P, Biswas A, Dey P, Biswas A. Patra PS, et al. Sci Rep. 2024 Jul 5;14(1):15555. doi: 10.1038/s41598-024-65476-5. Sci Rep. 2024. PMID: 38969735 Free PMC article.
• Application of Silicon Influencing Grain Yield and Some Grain Quality Features in Thai Fragrant Rice. Chan-In P, Jamjod S, Prom-U-Thai C, Rerkasem B, Russell J, Pusadee T. Chan-In P, et al. Plants (Basel). 2024 May 12;13(10):1336. doi: 10.3390/plants13101336. Plants (Basel). 2024. PMID: 38794407 Free PMC article.
• Search in MeSH

Related information

• Cited in Books

LinkOut - more resources

Full text sources.

• J-STAGE, Japan Science and Technology Information Aggregator, Electronic
• MedlinePlus Health Information
• Citation Manager

NCBI Literature Resources

MeSH PMC Bookshelf Disclaimer

The PubMed wordmark and PubMed logo are registered trademarks of the U.S. Department of Health and Human Services (HHS). Unauthorized use of these marks is strictly prohibited.

Advertisement

Disembedding grain: Golden Rice, the Green Revolution, and heirloom seeds in the Philippines

• Published: 16 April 2016
• Volume 34 , pages 87–102, ( 2017 )

Cite this article

• Glenn Davis Stone 1 &
• Dominic Glover 2  

10k Accesses

79 Citations

463 Altmetric

78 Mentions

Explore all metrics

“Golden Rice” has played a key role in arguments over genetically modified (GM) crops for many years. It is routinely depicted as a generic GM vitamin tablet in a generic plant bound for the global South. But the release of Golden Rice is on the horizon only in the Philippines, a country with a storied history and complicated present, and contested future for rice production and consumption. The present paper corrects this blinkered view of Golden Rice through an analysis of three distinctive “rice worlds” of the Philippines: Green Revolution rice developed at the International Rice Research Institute (IRRI) in the 1960s, Golden Rice currently being bred at IRRI, and a scheme to promote and export traditional “heirloom” landrace rice. More than mere seed types, these rices are at the centers of separate “rice worlds” with distinctive concepts of what the crop should be and how it should be produced. In contrast to the common productivist framework for comparing types of rice, this paper compares the rice worlds on the basis of geographical embeddedness, or the extent to which local agroecological context is valorized or nullified in the crop’s construction. The Green Revolution spread generic, disembedded high-input seeds to replace locally adapted landraces as well as peasant attitudes and practices associated with them. The disembeddedness of Golden Rice that boosts its value as a public relations vehicle has also been the main impediment in it reaching farmers’ fields, as it has proved difficult to breed into varieties that grow well specifically in the Philippines. Finally, and somewhat ironically, IRRI has recently undertaken research and promotion of heirloom seeds in collaboration with the export scheme.

This is a preview of subscription content, log in via an institution to check access.

Access this article

Subscribe and save.

• Get 10 units per month
• Download Article/Chapter or eBook
• 1 Unit = 1 Article or 1 Chapter
• Cancel anytime

Price includes VAT (Russian Federation)

Instant access to the full article PDF.

Rent this article via DeepDyve

Institutional subscriptions

Similar content being viewed by others

Adapting the Green Revolution for Laos

The Mystery of Black Rice: Food, Medicinal, and Spiritual Uses of Oryza glaberrima by Maroon Communities in Suriname and French Guiana

Lessons from the Asian Green Revolution in Rice

Most terms for the technology are contested, but genetically modified here simply refers to incorporation of recombinant DNA. GMO refers to a genetically modified organism.

Breeders and researchers in Viet Nam, India, and Bangladesh are also working with Golden Rice, but release is not on the horizon in any of these countries.

IRRI (see Fig.  2 ) collaborates with PhilRice—the Philippine Rice Research Institute—in the Golden Rice development and testing.

The rice sector in the Philippines is unusual in other respects outside the scope of this paper. Despite being a major rice producer, it is also one of the world’s largest importers of rice. It is also home to particularly advanced participatory breeding schemes for rice (Sievers-Glotzbach 2014 ).

For example, NERICA varieties, much heralded by breeders, have not been taken up with enthusiasm (Kijima et al. 2011 ).

Note too that none of the improvements anticipated in 2004 have come to pass. The “New Plant Type,” portrayed as a stage of progress already achieved, was incapable of out-yielding the best indica rice varieties (Peng et al. 2008 ); no transgenic rice varieties have yet been approved for commercial planting; and C4 rice (a proposed plant transformed to have a radically more efficient photosynthetic process) is a speculative product still far from potential release (Normile 2006 ; von Caemmerer et al. 2012 ). Datta expected that by 2015 breeders would be designing new crop varieties from scratch, but this remains a distant prospect (Cheung 2014 ; Long et al. 2015 ).

Some use “Green Revolution” for all “modern varieties” in developing countries (Evenson and Gollin 2003 ), although there were many differences between the 1960s revolution and later breeding (see Evenson 2004 ).

CIMMYT and IRRI are two of the network of 14 breeding and agricultural research centers comprising the Consultative Group on International Agricultural Research (CGIAR).

Also known as “early” varieties, this mainly meant photoperiod-insensitive plants that could be used for more than one cropping cycle per year.

At the time, the explicit treatment of locally adapted seeds and practices as problems to be overcome was challenged by few, the exception being geographer Carl Sauer (Richards 2004 , p. 266; Wright 1984 ).

This disembedding was reduced somewhat by placeless elite strains being distributed to other research centers where they were crossbred with other varieties. Well after the Green Revolution, IRRI breeders became more interested in non-ideotype breeding, as discussed below.

In Mexico, Borlaug had gone a step beyond ideal field conditions to outright rigged demonstrations in which conventional varieties were fertilized so heavily they fell over (Cullather 2010 , p. 191).

Monsanto has been eager to take credit for Golden Rice (Stone 2011b ), although it neither funded nor conducted research on Golden Rice. It did waive some of its patent rights on a promoter gene used in early experiments, but this gene has long since been replaced.

There are two publications specifically on potential impacts of Golden Rice in the Philippines. One of these (Zimmermann and Qaim 2004 ) includes no actual information about the Philippines beyond a few outdated countrywide health statistics. The other (Dawe et al. 2002 ) is an empirical study of VAD levels in an area where rice is neither a major crop nor a dominant starch in local diets.

Field trials of Golden Rice are also planned for Bangladesh and Indonesia, but commercial release in these countries appears to be much farther off.

The normal method of creating a GM crop is to (1) engineer a genetic construct containing one or more genes for desired traits, and then (2) expose cells from the target plant to an agent capable of inserting the construct into the cells’ DNA. Each instance where the construct is successfully integrated into the target cell DNA is a unique “transformation event.” Transformed cells are then selected and grown into whole plants that can be bred conventionally. There are several different Golden Rice 2 (GR2) transformation events; at least one is located in an exon and one in an intron associated with root development (Dubock 2014 , p. 81).

The javanica subspecies is now often classified as the tropical variant of the japonica subspecies.

The study by Tang et al. ( 2012 ) was retracted in July 2015 after an investigation revealed breaches of ethical procedures. See Retraction Watch ( 2015 ).

The rice is certified organic by the Organic Certification Center of the Philippines, but since OCCP standards are not yet recognized internationally, it is only labeled organic in the Philippines.

World Rice Statistics, http://ricestat.irri.org:8080/wrs2/entrypoint.htm (Accessed 27 June 2015).

CHRP growers produce yields of 2.8–3.8 MT/ha of unmilled rice. Elite rice cultivars such as China’s Y Liangyou 900 achieve yields approaching 15 MT/ha. in ideal conditions (Cheung 2014 ).

AllowGoldenRiceNow.org. 2015. http://www.allowgoldenricenow.org . Accessed 22 March 2016.

Beachy, R.N. 2003. Editorial: IP policies and serving the public. Science 299: 473.

Article   Google Scholar  

Borlaug, N.E. 1972. Breeding wheat for high yield, wide adaptation, and disease resistance. In Rice breeding , ed. IRRI, 581–589. Los Baños: International Rice Research Institute.

Bowen, S. 2011. The importance of place: Re-territorialising embeddedness. Sociologia Ruralis 51: 325–348.

Bradsher, K., and A. Martin. 2008. World’s poor pay price as crop research is cut. New York Times , 18 May.

Bray, F. 1994. Agriculture for developing nations. Scientific American 271: 30.

Brooks, S. 2008. Global science, public goods? Tracing international science policy processes in rice biofortification . Brighton: Institute of Development Studies, University of Sussex.

Google Scholar  

Brooks, S. 2010. Rice biofortification: lessons for global science and development . London: Earthscan.

Brooks, S. 2011. Living with materiality or confronting asian diversity? The case of iron-biofortified rice research in the Philippines. East Asian Science, Technology, and Society 5: 173–188.

Brooks, S. 2013. Biofortification: Lessons from the Golden Rice project. Food Chain 3: 77–88.

Charles, D. 2001. Lords of the harvest: Biotech, big money, and the future of food . Cambridge: Perseus.

Cheung, F. 2014. Yield: The search for the rice of the future. Nature 514: S60–S61.

Cronon, W. 1991. Nature’s metropolis: Chicago and the great west . New York: W.W. Norton and Company.

Cullather, N. 2003. Parable of seeds: The Green Revolution in the modernizing imagination. In The transformation of Southeast Asia: International perspectives on decolonization , ed. M. Frey, R.W. Pruessen, and T.T. Yong, 257–267. London: Routledge.

Cullather, N. 2004. Miracles of modernization: The Green Revolution and the apotheosis of technology. Diplomatic History 28: 227–254.

Cullather, N. 2010. The hungry world: America’s cold war battle against poverty in Asia . Cambridge: Harvard University Press.

Datta, S.K. 2004. Rice biotechnology: A need for developing countries. AgBioForum 7(1–2): 31–35.

Dawe, D., R. Robertson, and L. Unnevehr. 2002. Golden rice: What role could it play in alleviation of vitamin A deficiency? Food Policy 27: 541–560.

Dawe, D., and L. Unnevehr. 2007. Crop case study: GMO Golden Rice in Asia with enhanced Vitamin A benefits for consumers. AgBioForum 10: 154–160.

Domoguen, R.L. 2011. Cordillera losing its heirloom rice varieties. Sun Star . Baguio, 28 Feb.

Donald, C.M. 1968. The breeding of crop ideotypes. Euphytica 17: 385–403.

Dowd-Uribe, B. 2014. Engineering yields and inequality? How institutions and agro-ecology shape Bt cotton outcomes in Burkina Faso. Geoforum 53: 161–171.

Dowd-Uribe, B., D. Glover, and M. Schnurr. 2014. Seeds and places: The geographies of transgenic crops in the global south. Geoforum 53: 145–148.

Druguet, A. 2010. From the invention of landscapes to the construction of territories: The terraces of the Ifugaos (Philippines) and the Cevenols (France). PhD thesis, Anthropology, National Museum of Natural History.

Dubock, A. 2014. The present status of Golden Rice. Journal of Huazhong Agricultural University 33: 69–84.

DuPuis, E.M., and D. Goodman. 2005. Should we go “home” to eat? Toward a reflexive politics of localism. Journal of Rural Studies 21: 359–371.

Eighth Wonder. 2015. http://www.heirloomrice.com/index.php?p=project . Accessed 22 March 2016.

Eisenstein, M. 2014. Biotechnology: Against the grain. Nature 514: S55–S57.

Enserink, M. 2008. Tough lessons from golden rice. Science 320: 468–471.

Evans, N., C. Morris, and M. Winter. 2002. Conceptualizing agriculture: A critique of post-productivism as the new orthodoxy. Progress in Human Geography 26: 313–332.

Evenson, R.E. 2004. Food and population: D. Gale Johnson and the Green Revolution. Economic Development and Cultural Change 52: 543–569.

Evenson, R.E., and D. Gollin. 2003. Assessing the impact of the Green Revolution, 1960 to 2000. Science 300: 758–762.

Evenson, R.E., and D. Gollin. 1997. Genetic resources, international organizations, and improvement in rice varieties. Economic Development and Cultural Change 45: 471–500.

Food and Nutrition Research Institute. nd. Seventh national nutrition survey 2008–2009. Department of Science and Technology (Philippines).

Glover, D. 2010. The corporate shaping of GM crops as a technology for the poor. Journal of Peasant Studies 37: 67–90.

Golden Rice Project. nd. Testing the performance of Golden Rice. http://www.goldenrice.org/Content2-How/how8_tests.php . Accessed 22 March 2016.

Granovetter, M. 1985. Economic action and social structure: the problem of embeddedness. American Journal of Sociology 91: 481–510.

Guthman, J. 2004. Agrarian dreams: The paradox of organic farming in California . Berkeley: University of California Press.

Guthman, J., et al. 2007. Commentary on teaching food: Why I am fed up with Michael Pollan et al. Agriculture and Human Values 24: 261–264.

Haas, J.D., J.L. Beard, L.E. Murray-Kolb, A.M. del Mundo, A. Felix, and G.B. Gregorio. 2005. Iron-biofortified rice improves the iron stores of nonanemic Filipino women. The Journal of Nutrition 135: 2823–2830.

Hansen, M. 2013. Golden Rice myths. GMWatch website. http://gmwatch.org/index.php/news/archive/2013/15023-golden-rice-myths . Accessed 22 March 2016.

Harris, E. 2009. Neoliberal subjectivities or a politics of the possible? Reading for difference in alternative food networks. Area 41: 55–63.

Harris, E. 2010. Eat Local? Constructions of place in alternative food politics. Geography Compass 4: 355–369.

Harwood, J. 2015. Global visions vs. local complexity: Experts wrestle with the problem of development. In Rice: Global networks and new histories , ed. F. Bray, P.A. Coclanis, E.L. Fields-Black, and D. Schäfer, 41–55. New York: Cambridge University Press.

Chapter   Google Scholar  

Haskell, M.J. 2012. The challenge to reach nutritional adequacy for vitamin A: β-carotene bioavailability and conversion—evidence in humans. The American Journal of Clinical Nutrition 96: 1193S–1203S.

Holloway, L., and M. Kneafsey. 2004. Producing–consuming food: closeness, connectedness, and rurality. In Geographies of rural cultures and societies , ed. L. Holloway, and M. Kneafsey. London: Ashgate.

IRRI. nd. Why is Golden Rice needed in the Philippines since vitamin A deficiency is already decreasing? IRRI website. http://irri.org/golden-rice/faqs/why-is-golden-rice-needed-in-the-philippines-since-vitamin-a-deficiency-is-already-decreasing . Accessed 22 March 2016.

IRRI. 1977. IR8 and beyond . Los Baños: International Rice Research Institute.

IRRI. 2014a. What is the status of the Golden Rice project coordinated by IRRI? IRRI website. http://irri.org/golden-rice/faqs/what-is-the-status-of-the-golden-rice-project-coordinated-by-irri . Accessed 22 March 2016.

IRRI. 2014b. When will Golden Rice be available to farmers and consumers? IRRI website. http://irri.org/golden-rice/faqs/when-will-golden-rice-be-available-to-farmers-and-consumers . Accessed 22 March 2016.

IRRI. 2015. Heirloom rice: people place purpose (video). https://www.youtube.com/watch?v=blU9b3cQvoY . Accessed 22 March 2016.

ISAAA. 2014. The global status of commercialized biotech/GM Crops: 2014 (Brief No. 49). Ithaca: The International Service for the Acquisition of Agri-biotech Applications.

Kijima, Y., K. Otsuka, and D. Sserunkuuma. 2011. An inquiry into constraints on a Green Revolution in Sub-Saharan Africa: The case of NERICA Rice in Uganda. World Development 39: 77–86.

Kloppenburg Jr, J.R. 1991. Social theory and the de/reconstruction of agricultural science: Local knowledge for an alternative agriculture. Rural Sociology 56: 519–548.

Krock, B. 2009. Researchers look to enriched crops to solve childhood malnutrition. In Researchers look to enriched crops to solve childhood malnutrition. Student Life (Washington University), 28 Sept.

Kudlu, C., and G.D. Stone. 2013. The trials of genetically modified food: Bt eggplant and Ayurvedic Medicine in India. Food Culture and Society 16: 21–42.

Laborte, A.G., K. de Bie, E.M. Smaling, P.F. Moya, A.A. Boling, and M.K. Van Ittersum. 2012. Rice yields and yield gaps in Southeast Asia: Past trends and future outlook. European Journal of Agronomy 36: 9–20.

Lambrecht, B. 2001. Dinner at the new gene cafe: how genetic engineering is changing what we eat, how we live, and the global politics of food . New York: St. Martins Press.

Licnachan, E. 2015. Response from community stakeholders. Symposium on the Ifugao Rice Terraces. National Museum, Manila, Philippines, 18 June 2015.

Lobell, D.B., K.G. Cassman, and C.B. Field. 2009. Crop yield gaps: Their importance, magnitudes, and causes. Annual Review of Environment and Resources 34: 179–204.

Long, S.P., A. Marshall-Colon, and X. Zhu. 2015. Meeting the global food demand of the future by engineering crop photosynthesis and yield potential. Cell 161: 56–66.

Lotus Foods. 2015. Products. http://www.lotusfoods.com/index.php/products/ . Accessed 22 March 2016.

Maat, H., and D. Glover. 2012. Alternative configurations of agricultural experimentation. In Contested agronomy: agricultural research in a changing world , ed. J. Sumberg, and J. Thompson, 131–145. London: Routledge.

Mann, C. 2012. 1493: Uncovering the New World Columbus created . New York: Vintage Books.

McAfee, K. 2003. Neoliberalism on the molecular scale. Economic and genetic reductionism in biotechnology battles. Geoforum 34: 203–219.

Medina, J. 2013. FilAms urged to buy Philippine heirloom rice. Inquirer.net , 1 Oct. http://business.inquirer.net/145403/filams-urged-to-buy-philippine-heirloom-rice . Accessed 22 March 2016.

Montgomery, J.D. 1998. Toward a role-theoretic conception of embeddedness. Journal of Sociology 104: 92–125.

Morris, C., and J. Kirwan. 2011. Ecological embeddedness: an interrogation and refinement of the concept within the context of alternative food networks in the UK. Journal of Rural Studies 27: 322–330.

Murdoch, J., T. Marsden, and J. Banks. 2000. Quality, nature, and embeddedness: Some theoretical considerations in the context of the food sector. Economic Geography 76: 107–125.

Nestle, M. 2001. Genetically engineered “Golden” Rice unlikely to overcome vitamin A deficiency. Journal of the American Dietetic Association 101: 289–290.

Niblio, S.R. 1995. War, diplomacy, and development: The United States and Mexico, 1938–1954 . Wilmington: Scholarly Resources.

Normile, D. 2006. Consortium aims to supercharge rice photosynthesis. Science 313: 423.

Ohnuki-Tierney, E. 1993. Rice as self: Japanese identities through time . Princeton: Princeton University Press.

Otsuka, K., F. Gascon, and S. Asano. 1994. “Second-generation” MVs and the evolution of the Green Revolution: the case of Central Luzon, 1966–1990. Agricultural Economics 10: 283–295.

Peng, S., G.S. Khush, P. Virk, Q. Tang, and Y. Zou. 2008. Progress in ideotype breeding to increase rice yield potential. Field Crops Research 108: 32–38.

Pénicaud, C., N. Achir, C. Dhuique-Mayer, M. Dornier, and P. Bohuon. 2011. Degradation of β-carotene during fruit and vegetable processing or storage: Reaction mechanisms and kinetic aspects: A review. Fruits 66: 417–440.

Philippines Department of Health. nd. Micronutrient program. http://www.doh.gov.ph/micronutrient-program . Accessed 22 March 2016.

Polanyi, K., C. Arensberg, and H. Pearson. 1957. Trade and market in the early empires . New York: Free Press.

Qaim, M., and D. Zilberman. 2003. Yield effects of genetically modified crops in developing countries. Science 299: 900–902.

RAFI. 2000. Golden Rice and Trojan Trade Reps: A case study in the public sector’s mismanagement of intellectual property. RAFI Communique 66, Sept/Oct 2000. http://www.etcgroup.org/sites/www.etcgroup.org/files/publication/305/01/com_goldenrice.pdf . Accessed 22 March 2016.

Retraction Watch. 2015. Golden rice paper pulled after judge rules for journal. 30 July 2015. http://retractionwatch.com/2015/07/30/golden-rice-paper-pulled-after-judge-rules-for-journal/ . Accessed 22 March 2016.

Richards, P. 2004. Private versus public? Agenda-setting in international agro-technologies. In Agribusiness and society: Corporate responses to environmentalism, market opportunities and public regulation , ed. K. Jansen, and S. Vellema, 261–284. London: Zed.

Richards, P. 1997. Toward an African Green Revolution? An anthropology of rice research in Sierra Leone. In The ecology of practice: studies of food crop production in sub-Saharan West Africa , ed. A.E. Nyerges, 201–252. Amsterdam: Gordon and Breach.

Schurman, R., and W.A. Munro. 2010. Fighting for the future of food: Activists versus agribusiness in the struggle over biotechnology . Minneapolis: University of Minnesota Press.

Sekimoto, S., and L. Augustin-Jean. 2012. An export niche in the Philippines: The commodification of a speciality rice in Ifugao Province. In Geographical indications and international agricultural trade: The challenge for Asia , eds. L. Augustin-Jean, H. Ilbert, and N. Saavedra-Rivano, 181–203. Palgrave Macmillan.

Shiva, V. 2000–1. World in a grain of rice. The Ecologist Dec–Jan. 30:9.

Sievers-Glotzbach, S. 2014. Reconciling intragenerational and intergenerational environmental justice in Philippine agriculture: the MASIPAG farmer network. Ethics Policy and Environment 17: 52–68.

Soleri, D., D.A. Cleveland, G. Glasgow, S.H. Sweeney, F. Aragón Cuevas, M.R. Fuentes, and H. Ríos. 2008. Testing assumptions underlying economic research on transgenic food crops for Third World farmers: Evidence from Cuba, Guatemala, and Mexico. Ecological Economics 67: 667–682.

Stein, A.J., H.P.S. Sachdev, and M. Qaim. 2006. Potential impact and cost-effectiveness of Golden Rice. Nature Biotechnology 24: 1200–1201.

Stone, G.D. 2002. Both sides now: Fallacies in the genetic-modification wars, implications for developing countries, and anthropological perspectives. Current Anthropology 43: 611–630.

Stone, G.D. 2011a. Field versus farm in warangal: Bt cotton, higher yields, and larger questions. World Development 39: 387–398.

Stone, G.D. 2011b. Golden Rice, soon. Or not. FieldQuestions blog. http://fieldquestions.com/2011/05/30/golden-rice-soon-or-not/ . Accessed 22 March 2016.

Stone, G.D. 2015. Biotechnology, schismogenesis, and the demise of uncertainty. Journal of Law and Policy 47: 29–49.

Tang, G., Y. Hu, S. Yin, Y. Wang, G.E. Dallal, M.A. Grusak, and R.M. Russell. 2012. b-Carotene in Golden Rice is as good as b-carotene in oil at providing vitamin A to children. American Journal of Clinical Nutrition 96:658–664 [Retracted, August 2015].

Tripp, R. 1996. Biodiversity and modern crop varieties: sharpening the debate. Agriculture and Human Values 13: 48–63.

von Caemmerer, S., W.P. Quick, and R.T. Furbank. 2012. The development of C4 rice: Current progress and future challenges. Science 336: 1671–1672.

Wesseler, J., S. Kaplan, and D. Zilberman. 2014. The cost of delaying approval of Golden Rice. Agricultural and Resource Economics Update 17(3): 1–3.

Winter, M. 2003. Embeddedness, the new food economy, and defensive localism. Journal of Rural Studies 19: 23–32.

Witt, H., R. Patel, and M. Schnurr. 2006. Can the poor help GM Crops? Technology, representation, and cotton in the Makhathini Flats, South Africa. Review of African Political Economy 109: 497–513.

Woods, M. 2002–3. Food for thought: The biopiracy of Jasmine and Basmati rice. Albany Law Journal of Science and Technology 13:123–143.

Wright, A. 1984. Innocents abroad: American agricultural research in Mexico. In Meeting expectations of the land , ed. W. Jackson, et al., 135–151. Berkeley: North Point Press.

Ye, X., S. Al-Babili, A. Kloti, J. Zhang, P. Lucca, P. Beyer, and I. Potrykus. 2000. Engineering the provitamin A (beta-carotene) biosynthetic pathway into (carotenoid-free) rice E. Science 287: 303.

Zimmermann, R., and M. Qaim. 2004. Potential health benefits of Golden Rice: A Philippine case study. Food Policy 29: 147–168.

Download references

Acknowledgments

Major funding for this research came from the John Templeton Foundation initiative, “Can GM Crops Help to Feed the World?” Additional funds came from the ESRC STEPS Centre at Sussex University, UK. For assistance and insights we are grateful to Bruce Tolentino and Nollie Vera Cruz of IRRI; Marlon Martin and Jacy Moore of SITMo; Stephen Acabado of UCLA; Jovy Camso of Mountain Province Agriculture Department; Vicky Garcia, Mary Hensley, and Jimmy Lingayo of the CHRP; Tony La Viña of Ateneo School of Government; Tony Alfonso formerly of PhilRice; Amber Heckelman of University of British Columbia; Priscilla Stone of S.I.T.; and two anonymous referees.

Author information

Authors and affiliations.

Department of Anthropology, Washington University, St. Louis, MO, 63130, USA

Glenn Davis Stone

Institute of Development Studies, University of Sussex, Brighton, BN1 9RE, UK

Dominic Glover

You can also search for this author in PubMed   Google Scholar

Corresponding author

Correspondence to Glenn Davis Stone .

Rights and permissions

Reprints and permissions

About this article

Stone, G.D., Glover, D. Disembedding grain: Golden Rice, the Green Revolution, and heirloom seeds in the Philippines. Agric Hum Values 34 , 87–102 (2017). https://doi.org/10.1007/s10460-016-9696-1

Download citation

Accepted : 30 March 2016

Published : 16 April 2016

Issue Date : March 2017

DOI : https://doi.org/10.1007/s10460-016-9696-1

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Genetically modified crops
• Golden Rice
• Green Revolution
• Heirloom crops
• Find a journal
• Publish with us
• Track your research

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings

The PMC website is updating on October 15, 2024. Learn More or Try it out now .

• Advanced Search
• Journal List
• Plants (Basel)

The 21st Century Agriculture: When Rice Research Draws Attention to Climate Variability and How Weedy Rice and Underutilized Grains Come in Handy

Noraikim mohd hanafiah.

1 Functional Omics and Bioprocess Development Laboratory, Institute of Biological Sciences, Faculty of Science, University of Malaya, Kuala Lumpur 50603, Malaysia

Muhamad Shakirin Mispan

2 The Centre for Research in Biotechnology for Agriculture, University of Malaya, Kuala Lumpur 50603, Malaysia; ym.ude.mu@nirikahs

Phaik Eem Lim

3 Institute of Ocean and Earth Science, University of Malaya, Kuala Lumpur 50603, Malaysia; ym.ude.mu@meekiahp

Niranjan Baisakh

4 School of Plant, Environmental, and Soil Science, Louisiana State University Agricultural Center, Louisiana State University, Baton Rouge, LA 70803, USA

Rice, the first crop to be fully sequenced and annotated in the mid-2000s, is an excellent model species for crop research due mainly to its relatively small genome and rich genetic diversity. The 130-million-year-old cereal came into the limelight in the 1960s when the semi-dwarfing gene sd-1 , better known as the “green revolution” gene, resulted in the establishment of a high-yielding semi-dwarf variety IR8. Deemed as the miracle rice, IR8 saved millions of lives and revolutionized irrigated rice farming particularly in the tropics. The technology, however, spurred some unintended negative consequences, especially in prompting ubiquitous monoculture systems that increase agricultural vulnerability to extreme weather events and climate variability. One feasible way to incorporate resilience in modern rice varieties with narrow genetic backgrounds is by introgressing alleles from the germplasm of its weedy and wild relatives, or perhaps from the suitable underutilized species that harbor novel genes responsive to various biotic and abiotic stresses. This review reminisces the fascinating half-century journey of rice research and highlights the potential utilization of weedy rice and underutilized grains in modern breeding programs. Other possible alternatives to improve the sustainability of crop production systems in a changing climate are also discussed.

1. Introduction

The blueprint to achieve a more sustainable future for all, or better known collectively as the sustainable development goals (SDGs), was developed by the United Nations in 2015 as a universal call for action to protect the earth, end poverty, and ensure that humans live in peace and prosperity [ 1 , 2 ]. Agriculture, the largest user of natural resources like water and land in the world, plays a direct role in achieving some of the 17 developed SDGs, especially in terms of water, biodiversity, climate change, poverty, sustainable energy, and cities [ 3 ]. The green revolution (GR) succeeded in increasing crop production after the mid-20th century and saved millions of lives [ 4 ]. However, a new paradigm of green agriculture, where less resources are used to grow crops, is required in the current century to feed the ever-growing population amid climate change. The Fifth Assessment Report prepared by the Intergovernmental Panel on Climate Change in 2014 stated that crop yield in low-latitude countries would be consistently and negatively affected by climate change. The average global temperature increased by ~0.13 °C since the 1950s and is expected to grow at a faster pace (~0.2 °C per decade) in the next several decades [ 5 ]. The increment in maximum temperature in certain locations may affect the yield and reproduction of many important crops [ 6 ]. For instance, a one-degree increase in the maximum temperature in Nepal caused a decrease in rice production to an average of about 130 kg/ha [ 7 ]. A more coherent and systematic approach to global food production is, therefore, crucial for sustainable agriculture in the 21st century [ 8 , 9 ].

The true grass family Poaceae (or Gramineae) is long considered as the most economically important plant family for food production, comprising more than 10,000 species, which include the “big three” cereals—wheat ( Triticum aestivum ), maize ( Zea mays ), and rice ( Oryza sativa ) [ 10 ]. Rice, with over 40,000 distinct varieties grown on every continent except Antarctica [ 11 , 12 ], is the most important food crop in the developing world [ 13 , 14 ]. It is a dependable staple for more than half of the entire world’s population, including about 550 million undernourished people living in Asia [ 15 , 16 ]. The genus Oryza , which emerged almost 130 million years ago, consists of 22 wild and two cultivated species, namely O. sativa and O. glaberrima [ 17 ]. Pericarp color, dormancy, shattering, panicle architecture, and tiller number are among the primary traits used to differentiate between the wild and cultivated species [ 18 ]. The wild rice O. rufipogon , commonly known as Asian rice, is the recognized progenitor of O. sativa that contains two major subspecies: long-grain, non-sticky indica rice and short-grain, sticky japonica rice [ 19 ]. Based on a geographical analysis, indica rice was domesticated in the Himalayas, likely eastern India, while japonica rice was domesticated in southern China [ 20 ]. The African cultivated rice O. glaberrima , on the other hand, is grown in small areas in West Africa [ 21 ].

The old saying “rice is life” reflects the importance of this ancient grain to humankind not only as a staple food but also as cultural and spiritual sustenance [ 22 ]. Through the lens of science, rice is an excellent model species for plant biology research, particularly for studies on monocotyledonous plants, due to its relatively small genome size of 430 Mb [ 23 , 24 , 25 ]. It is the first crop to be fully sequenced, furnishing a valuable reservoir of genetic variation for numerous agriculturally important traits such as yield and stress tolerance [ 18 ]. Oryza species were classified into three main groups (or complexes), called the primary, secondary, and tertiary gene pools, based mainly on the ease of gene transfer into cultivated species [ 11 , 23 , 26 ]. The primary gene pool ( O. sativa complex) consists of Asian cultivated rice ( O. sativa ), weedy rice ( O. sativa f. spontanea ), wild ancestor species ( O. rufipogon and O. nivara ), and other AA-genome variant species. The O. sativa complex constitutes primarily the diploid AA-genome species (2n = 24) with perfect synapsis and relatively high sexual compatibility, and pollen and panicle fecundity of F1 hybrids [ 21 ]. The secondary gene pool ( O. officinalis complex) encompasses other non-AA-genome species, whereas the tertiary gene pool ( O. meyeriana and O. ridleyi complex) consists of species of other genera in the tribe Oryzeae [ 27 ].

The past half-century witnessed a handful of eminent scientific innovations for agricultural systems, from the development of high-yielding semi-dwarf varieties of various major crops through systematic breeding programs to more sophisticated studies of plants at the molecular level, with the latest innovation being the clustered regularly interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein 9 (Cas9) gene-editing technology [ 28 , 29 ]. In rice specifically, its first completed public genome not only contributed to significant advancements in its genetics and breeding but also paved the way for the sequencing of more complicated crop genomes such as wheat and maize [ 30 ]. Nonetheless, the fact that the global demand for rice is continually increasing while its production per capita is decreasing makes it necessary for researchers to constantly look for critical ways to further improve the crop. Although one of the notable challenges in rice production is the presence of weedy rice [ 31 ], recent studies suggested that weedy rice has novel sources of resistance to devastating rice diseases such as sheath blight (caused by Rhizoctonia solani ) and blast (caused by Magnaporthe oryzae ) that cause severe crop losses worldwide [ 32 ]. In this review, we attempted to synthesize the past research on rice biology and genetics and highlight the main gaps and future directions in rice research. We also discussed the potential utilization of weedy rice and underutilized grain crops in the development of climate-resilient rice varieties.

2. Highlights of Rice Research since the Green Revolution

The GR in the 1960s resulted in the development of IR8, the first semi-dwarf, high-yielding variety (HYV) of rice by the International Rice Research Institute (IRRI). The seeds of the IR8, hailed as “miracle seeds”, were credited with saving millions of lives in many famine-prone countries, particularly those in Asia such as India and China [ 33 ]. Nevertheless, its reliance on heavy doses of fertilizers and irrigation to maximize yield sparked controversy for decades [ 34 ]. As the 21st century heralds a new GR, it is essential to dwell on the past achievements and failures during the early and late GR to make sure that all critical aspects of crop improvement are thoroughly considered for the next, greener revolution.

2.1. Early Green Revolution

The discovery of the semi-dwarfing ( sd-1 ) gene by the late Norman E. Borlaug, a Nobel Peace Prize Laureate who is known as the Father of GR, dramatically enhanced the development of HYV throughout the world, remarkably for the big three cereals. The semi-dwarf trait became credible in supporting the heavy grains of HYVs and preventing the plants from lodging. Between 1966 and 1986, short-statured rice varieties adopted approximately 60% of the global rice land [ 35 ]. The first HYV IR8 was derived from the cross between Dee-geo-woo-gen (DGWG), a dwarf Chinese variety with the Sd-1 gene and Peta variety from Indonesia which is tall, vigorous, and good in taste [ 33 ]. It was released in 1966, and quickly became the most planted rice variety in some areas of Asia. Although the IR8 has some remarkable traits such as lodging resistance and good fertilizer response, it also possesses several drawbacks, with the major ones being its long growth duration (i.e., matures in 130 days) and susceptibility to many diseases and insects. Thereupon, the breeding programs at IRRI focused mainly on the development of short-duration and/or multiple disease- and insect-resistant varieties, leading to the release of ~30 IR varieties by the mid-1980s [ 35 ]. In addition to having a considerably short growth cycle, newly developed modern rice varieties such as IR36, IR50, and IR64 are photoperiod-insensitive and can be planted at any time of the year [ 36 ].

The success of the IR8 was recognized globally by breeders working on rice and beyond. Semi-dwarf varieties were widely used as the donor parent in many intensive breeding programs for other major food crops such as wheat [ 37 ] and maize [ 38 ]. The modern varieties, by and large, respond better to nitrogen fertilizer compared to the traditional varieties, which usually grow excessively tall, lodge early, and produce tiller extensively with low yields [ 36 ]. However, it is important to note that the production of the modern varieties requires the utilization of a substantial amount of chemical fertilizers and pesticides, with the adoption of efficient irrigation systems to boot [ 39 , 40 ]. Another major issue of growing modern varieties is the increase in monoculture, continuous cultivation of a uniform crop variety on a particular land, which reduces the genetic diversity of crops and agricultural system, thus increasing the crop vulnerability to agricultural risks, notably disease and pest infestation [ 1 , 34 ]. Monoculture is now dominant in many countries, especially those that benefited from GR.

2.2. Late Green Revolution

The global production of wheat, maize, and rice in many parts of the world increased regularly since the 1960s, and it nearly doubled within a mere two decades that consequently reduced famine and hunger crises [ 41 ]. Between 1980 and 2000, the world population grew from 4.4 billion to 6.1 billion, with more than 90% of the growth occurring in developing countries. The agricultural areas in these countries grew from 2.85 billion ha in 1980 to 3.17 billion ha in 2001 [ 42 ]. The production of rice in the year 2000 increased by more than 200% in certain countries. Since the release of the IR8 variety in 1966, ~70% of world’s rice land was planted with HYV during the mid-1990s, and their distinctive characteristics include higher yield potential, improved grain quality, shorter growth duration, and resistance to multiple diseases and insects [ 36 ].

The late GR saw tremendous improvement in the efficient use of molecular and cellular approaches in rice research. Genetic engineering in rice began way back in the 1980s, with the first transgenic rice reported in the late 1980s [ 43 , 44 ]. Significant advancements in the genetic transformation of rice were made since then, with numerous gene transfer protocols with appropriate promoters, markers, and reporter genes being developed and employed to introgress foreign genes into rice. Standardized protocols for the production of transgenic rice of more than 60 rice varieties that include indica , japonica , javanica , and elite African cultivars are also reportedly available [ 45 ]. Much focus was given to developing rice with resistance toward insects [ 46 ], pests [ 47 ], viruses [ 48 ], and diseases such as sheath blight [ 48 ] and bacterial leaf blight [ 49 ]. One renowned example is the genetically engineered, insect-resistant Bt rice which was developed by introducing the insecticidal genes from Bacillus thuringiensis Berliner (Bt) into rice [ 50 ]. Although Bt rice showed good resistance to yellow and striped stem borer, both in laboratory and in field conditions, its commercial planting was long delayed due to regulatory restrictions for food safety concerns [ 51 ]. While the development of transgenic rice focused mainly on insect and disease resistance during the 1990s, the most remarkable success story at that time is perhaps the development of beta-carotene-producing golden rice [ 52 ], a nutritionally enhanced genetically modified crop which was only recently approved safe for human consumption in the Philippines after obtaining food safety approval from Australia, New Zealand, and the United States [ 53 , 54 ].

Rice research continued to grow and flourish as it entered the new millennium, taking its improvement far beyond the conventional practice limits. With the development of linkage and qualitative trait locus (QTL) maps, marker-assisted selection (MAS) is the most common approach used internationally. This is particularly the case for developing high-yielding rice with improved resistance against biotic and abiotic stresses, which was one of the primary goals to improve global rice production during the late era of GR [ 11 , 55 ]. Most successful examples of MAS include the development of rice introgressed with Xa genes for bacterial blight resistance and Sub1A for submergence tolerance [ 56 ]. Genome-wide association studies (GWAS) represent another powerful tool used to dissect the genetics and identify markers associated with complex traits in rice, including flowering time, plant height, grain yield, and grain shape for use in MAS [ 57 , 58 ].

2.3. 21st Century

The completion of the rice genome in the mid-2000s marked a momentous milestone in rice research, opening seemingly endless doors for gene discovery not only in rice but also in other crops [ 59 , 60 ]. Rice, together with thale cress ( Arabidopsis thaliana ) that had its genome completed in 2001 [ 61 ], are the best-characterized model species in plant biology [ 23 , 62 ]. Nevertheless, rice is a C3 crop that has considerably lower photosynthetic efficiency than C4 crops such as maize and sorghum [ 63 ]. Much research was devoted to engineering C4 photosynthetic traits into rice, which could increase its yield up to 50% while using half the water. During the last decade, more than 20 comparative transcriptomic studies were published with the identification of potential C4 genes and their regulatory mechanisms [ 64 ]. This was made possible by advances in next-generation sequencing technologies, gene discovery, and, more recently, genome editing platforms [ 65 ].

At present, there are four major tools for genome editing, which include zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), meganuclease, and the latest one being the CRISPR/Cas system. CRISPR/Cas system, which utilizes the adaptive mechanism of prokaryotes toward foreign deoxyribonucleic acid (DNA) fragments, successfully generated mutagenesis in transgenic rice [ 66 ]. The past decade saw a noticeable increase in the application of CRISPR/Cas genome editing in plant research, especially after the successful expression of the system in two monocot (rice and sorghum, Sorghum bicolor ) and dicot (thale cress and tobacco, Nicotiana tabacum ) plants [ 67 ]. The system was utilized for multigene knockouts in plants, for example, targeted mutagenesis of paralogous cyclin-dependent kinase ( CDK ) genes in rice [ 68 ]. The study conducted by Shan et al. [ 28 ] proved that the CRISPR/Cas system was a rapid method for gene targeting in rice protoplasts (within 1–2 weeks) for generating mutated rice plants (within 13–17 weeks). Currently, the CRISPR/Cas9 system is widely used to edit genes associated with yield, quality, and disease resistance in rice. The important milestones in rice research since the GR are displayed in Figure 1 .

Milestones in rice research since green revolution.

3. Weedy Rice and Underutilized Grain Crops as Potential Complement to Existing Rice Research

The 21st century witnessed increasing attention among researchers in laying a strong foundation for a greener revolution, where improved crop varieties require less inputs, especially water and fertilizer, to feed the estimated 9.8 billion people by the mid-century [ 69 , 70 ]. Cantrell and Hettel [ 71 ] highlighted that rice research in the 21st century should emphasize how to reduce both the production and the research gaps, along with strategic research plans to develop and utilize new technologies and tools. With the constant rise in food demand and rapid changes in consumption patterns, radical research approaches are crucial to complement fundamental exploration in improving both major and underutilized (or orphan and neglected) plant species [ 72 , 73 ]. In fact, the past decade saw the emergence of multiple studies on the lesser known plants as one of the prime strategies in strengthening the four pillars of food security, which include the availability, access, utilization, and stability of food [ 1 , 74 ].

In the recent past, unique research trends were observed in many rice improvement programs globally, from uncovering the worth of the undesirable weedy rice to unearthing the potential of underutilized crops in achieving sustainable rice production. Weedy or obnoxious red rice, known as the unwanted plants of Oryza , was recently reported to possess novel sources of stress tolerance or resistance, although its presence can lead to the reduction of both the quantity and quality of the cultivated grains [ 32 ]. Evolved as an intermediate between the wild and cultivated species, weedy rice generally exhibits a high competitive ability against cultivated rice for resources and it is considered a serious threat to rice production in many major rice-producing countries [ 75 ]. Ironically, the competitive ability and adaptive evolutionary traits of weedy rice such as stress tolerance, increased seed dispersal, and dormancy [ 76 , 77 , 78 , 79 ] could be useful to maximizing resource use efficiency and yield of rice amidst the current rapid climate uncertainties. The study conducted by Ziska et al. [ 80 ] demonstrated that weedy rice responded positively to elevated temperature and carbon dioxide (CO 2 ) concentration, showing height increase with greater tiller and panicle formation.

Apart from having resistance to abiotic stresses, weedy rice also displays a high degree of resistance toward certain biotic stresses, such as rice blast and sheath blight caused by Magnaporthe oryzae and Rhizoctonia solani , respectively [ 32 ]. A total of 28 QTLs associated with blast resistance were identified from two weedy rice ecotypes present in the United States, namely, black hull awned and straw hull awnless [ 81 ]. Furthermore, the tallness of weedy rice helps it to avoid damage by sheath blight disease that causes injury to rice stem, leaf, and sheath [ 32 ]. Table 1 summarizes some important genes linked to biotic and abiotic stresses in weedy rice. Exploiting the full potential of weedy rice, especially its gene pools, can be beneficial for breeding and evolutionary studies of modern rice [ 82 ]. The virtue of weedy rice is finally deliberated, and this is most likely driven by the increased knowledge and awareness on the adverse effects of climate change.

Examples of important genes linked to biotic and abiotic stresses in weedy rice.

Urbanization is one of the most dominant demographic trends, with approximately 70% of the world’s population projected to live in cities by the mid-century [ 89 ]. In urban environments, dietary habits and meal patterns can vary significantly between the rich, the middle class, and the poor communities. With varying diet regimes among the urban communities especially those in developed nations, the challenge of fulfilling consumer needs and demands becomes bigger than ever [ 90 , 91 , 92 ]. Many researchers today would agree that the development of underutilized crops that feed only certain communities is equally important as the improvement of common staple crops such as rice that feed the majority [ 72 , 93 , 94 ]. This perhaps explains why the research on underutilized crops gained momentum in the current era. Not only are these crops important in materializing a diversified food basket, but they are also valuable genetic resources for breeding programs of major crops and maintaining global biodiversity [ 34 , 95 ].

A group of long-overlooked ancient grain crops, such as teff ( Eragrostis tef ), quinoa ( Chenopodium quinoa ), and amaranth ( Amaranthus spp.) to name a few, finally received the research attention that they deserve in the last couple of years due mainly to their hardiness, versatility, and exquisite nutritional benefits [ 1 , 92 , 95 , 96 ]. These underutilized crops were a staple in their native homes for hundreds of years, and they possess some degree of tolerance to certain stresses, as shown in Table 2 [ 97 , 98 , 99 , 100 , 101 , 102 , 103 , 104 ]. An evidential example of their superior genes of nutrional importance is the development of protato (protein-rich potato) that was engineered to express the AmA1 albumin protein of Amaranthus hypochondriacus [ 105 ]. This suggests that the genetic and genomic resources of such potential underutilized crops can be exploited to improve rice cultivars through identification and transfer of desirable alleles or traits. A simplified phylogenetic relationship between the discussed grain crops is presented in Figure 2 .

Simplified phylogenetic relationship between selected crops in the Poaeeae and Amaranthaceae families modified from References [ 106 , 107 ]).

Fundamentals and important attributes of potential underutilized grains.

Sources: [ 1 , 97 , 98 , 99 , 100 , 101 , 102 , 103 , 104 ]).

4. Laying the Route to Sustainable Rice Production: What Can We Possibly Do?

The principal aim of sustainable crop production is to optimize production by sustainably managing biological processes, biodiversity, and ecosystem services, while considering the key factors, such as economic, political, social, and environmental effects [ 108 ]. In a narrower sense, sustainable rice production is achieved when production per unit area increases as a result of ecologically regenerative approaches that integrate biodiversity and soil health rather than excessive utilization of inputs such as chemical fertilizers and pesticides [ 109 ]. Figure 3 presents several strategies which can potentially contribute significantly to sustainable rice production. It is important to ensure that the strategies used will offer socio-economic benefits to producers, both large- and small-scale, and to society for all social classes.

Plausible strategies to achieve sustainable rice production.

According to Gerber [ 110 ], a sustainable agricultural system is based mainly on the prudent use of both recyclable and renewable resources. By contrast, a system that depends on finite natural resources cannot be sustained indefinitely. The use of renewable resources (such as wind, solar, and biomass energy) to grow rice is generally still limited [ 111 ]. One of the major barriers to adopting these technologies is capital and/or construction costs, which could be overcome by implementing renewable energy subsidies to rice farmers. The promotion and utilization of renewable resources in rice fields can help promote long-term environmental stewardship, especially in relation to conserving soil quality, the main factor influencing rice production [ 112 ]. Sustainable rice production can also be supported by other means such as simplified and reduced-input farming practices. A dynamic rice production system should allow producers to choose and adopt the best combinations of practices based on their local environmental conditions and production constraints, achieving high levels of output with minimal inputs. One notable example is the system of rice intensification (SRI) ( Figure 3 ), which recommends some sustainable agronomic practices such as application of compost or organic fertilizers and draining extra water in order to keep rice fields in saturated, non-flooded conditions [ 113 ].

Genetically improved grain crops accounted for an increase in yield of more than 50% in recent decades, and plant breeders must achieve similar or better results to feed the growing population [ 114 ]. Rice should continue to be improved along with those rising underutilized crops. With the many potential future effects of global warming, rice breeders need to develop a genetically diverse portfolio of improved cultivars that are well suited to a wide range of farming practices and agro-ecosystems [ 115 ]. During the last century, about three-quarters of crop genetic diversity disappeared; hence, increased support in collecting and conserving genetic resources is much needed [ 116 ]. Crop diversification is one of the crucial ways to preserve the genetic diversity. However encouraging the substitution of common crop staples with lesser known crops certainly does not happen overnight in every part of the world [ 1 ].

A suitable complement to sustainable farming is smart farming, where automated and connected agriculture are applied. Smart farming enables sophisticated field management by integrating advanced technologies, such as unmanned aerial vehicles (UAVs), artificial intelligence (AI), and Internet of things (IoT) into existing farming practices [ 117 ]. The utilization of different sensors and connected devices in smart farming are tailored specifically to optimize the quality and quantity of inputs, while preserving resources, from delivering visibility into crop and soil health to predicting crop performance and detecting outbreaks of harmful pests [ 118 ]. For rice production, smart farming recently became routine in some countries (such as the United States and Japan) that can afford the high cost of technology [ 119 ]. A more cost-effective and flexible smart farming system is pivotal to attract more rice-producing countries to adopt this farm management concept in the near future. It is feasible that small- to medium-sized farming operations could begin by implementing precision farming technologies that monitor and analyze the needs of individual crops and fields. Unlike smart farming (which involves connected technologies that link to all farm operations), precision technologies focus on precise measurements using individual sensors or devices, thus offering economic flexibility that is easier to establish [ 120 ].

To encourage low- and medium-income rice producers to engage in sustainable farming practices, many of the current agricultural policies will need to be revised. New policies should eliminate any existing subsidies that drive producers to overuse resources [ 121 ]. For example, incentives that encourage the use of fertilizers need to be removed [ 122 ]. Alternatively, policymakers could provide incentives for producers to utilize natural resources wisely. It is important for policymakers to commit to engaging with and transferring knowledge to producers, in the interest of supporting the improvements in their livelihoods and in social conditions. The gap between sustainable agricultural policies and how they are perceived should be identified, and a clear approach on how to adopt these policies should be defined.

Undoubtedly, rice, being one of the world’s major crops with a small genome size, garnered plenteous attention from the scientific community [ 123 ]. Unfortunately, this crop suffered a loss in genetic diversity, especially after the GR, where monoculture farming that relies heavily on chemical inputs began to monopolize most croplands [ 124 ]. It was reported that yields in many major rice-producing countries such as China is plateauing, and the yield gap between rice fields (actual yield) and research stations (potential yield) is still an ongoing issue in many countries [ 125 ]. Closing this gap is essential and requires collaborative efforts between breeders and governments to ensure that rice production continues to increase in a sustainable manner. Major investment for rice research is needed to revitalize breeding programs and technology transfer schemes in developing countries to provide producers with improved varieties and the knowledge of appropriate technologies, as well as to enhance their skills through suitable programs, such as farmer field schools.

Acknowledgments

The authors would like to thank the University of Malaya. A.C. was supported as a Borlaug Fellow at the Louisiana State University Agricultural Center under a project from the USDA-FAS Borlaug Fellowship Program to N.B.

Author Contributions

A.C. conceptualized the review. N.B. acquired the funding. N.M.H. and A.C. wrote the paper. M.S.M., P.E.L. and N.B. read and critically revised the paper. All authors have read and agreed to the published version of the manuscript.

This manuscript was funded by the United States Department of Agriculture Foreign Agricultural Service (USDA-FAS) [Agreement No. FX18BF-10777R040].

Conflicts of Interest

The authors declare no conflicts of interest.

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

• View all journals
• Explore content
• About the journal
• Publish with us
• Sign up for alerts
• Open access
• Published: 28 September 2024

A time-course transcriptomic analysis reveals the key responses of a resistant rice cultivar to brown planthopper infestation

• Meng Dong 1   na1 ,
• Chunzhu Wu 1   na1 ,
• Ling Lian 1 ,
• Longqing Shi 1 ,
• Zhenxing Xie 1 ,
• Junian Zhang 1 &
• Zhaowei Jiang 1  

Scientific Reports volume  14 , Article number:  22455 ( 2024 ) Cite this article

Metrics details

• Plant breeding
• Transgenic plants

The brown planthopper (BPH) is one of the most problematic pests affecting rice ( Oryza sativa L.) yields in Asia. Breeding rice varieties containing resistance genes is the most economical and effective means of controlling BPH. In this study, the key factors in resistance to BPH were investigated between the high-resistance rice variety “R26” and the susceptible variety “TN1” using RNA-sequencing. We identified 9527 differentially expressed genes (DEGs) between the rice varieties under BPH-induced stress. Weighted time-course gene co-expression network analysis (WGCNA) indicated that the increased expression of genes is associated with plant hormones, MAPK signaling pathway and biosynthesis of other secondary metabolites, which were involved in disease resistance. A connection network identified a hub gene, OsREM4.1 (BGIOSGA024059), that may affect rice resistance to the BPH. Knocking out OsREM4.1 in rice can lead to a decrease in callose, making it less resistant to BPH. Overall, the expression of differentially expressed genes varies among rice varieties with different resistance in BPH invasion. Inaddition, R26 enhances resistance to BPH by upregulating genes and secondary metabolites related to stress resistance and plant immunity. In summary, our study provides valuable insights into the genome-wide expression profile of DEGs in rice under BPH invasion through high-throughput sequencing, and further suggests that R26 can be used to develop high resistance rice lines in BPH resistant breeding programs.

Similar content being viewed by others

Transcriptome analysis of xa5 -mediated resistance to bacterial leaf streak in rice ( Oryza sativa L.)

Deciphering signalling network in broad spectrum Near Isogenic Lines of rice resistant to Magnaporthe oryzae

Transcriptome-based analysis of resistance mechanism to black point caused by Bipolaris sorokiniana in wheat

Introduction.

Rice is an important food crop worldwide, and the development of improved rice varieties is crucial for ensuring global food security. Pest infestation is among the most significant stress factors affecting rice yield. The brown planthopper (BPH) Nilaparvata lugens (Stål), a monophagous insect that feeds on rice, has caused extensive damage to the rice industry in China and many other parts of Asia, leading to a marked reduction in yields 1 , 2 .

At present, the use of chemical insecticides is the fastest and most powerful method for managing BPH 3 . However, chemical control methods can be detrimental to human health and the environment, and have brought about insecticide-resistant BPH biotypes 4 , 5 , 6 . Rice has developed a complex defense system against BPH, and BPH-resistant rice varieties are mainly obtained through conventional sexual hybrid breeding; however, this requires a long breeding time and a large workload in seed selection, and it is difficult to rapidly obtain excellent resistant varieties. Therefore, utilizing insect resistance genes in rice to develop resistant rice varieties represents a promising and sustainable method for controlling rice planthopper infestation. Exploring the genes for broad-spectrum and persistent resistance to BPH is a prerequisite of gene aggregation breeding for the selection of new varieties to control BPH damage 7 . The effects of different resistance genes on the physiological metabolism of BPH are different, indicating that the mechanism of action is specific to rice variety, and transcriptome analysis provides an important basis for further understanding of its function 8 , 9 . Transcriptomic and metabolomic association analysis showed that rice promoted BPH resistance by inducing epigallocatechin and reducing indole acetic acid (IAA) 10 . In addition, transcriptome sequencing identified 14,358 DEGs and 55 potential BPH stress players related to resistance to BPH 11 . Furthermore, single cell sequencing showed that mesophyll cells may regulate the expression of vanillin, capsaicin and reactive oxygen species (ROS) production genes, phloem cells may regulate cell wall extension genes, and xylem cells may participate in BPH resistance by controlling the expression of chitin and pectin related genes 9 . The accumulation of callose in resistant rice prevented BPH infestation, and the exogenous abscisic acid (ABA) enhanced rice resistance to BPH by promoting callose formation 12 , 13 .

In recent years, there have been increasing outbreaks of the BPH in China, which is a serious threat to rice yield. Therefore, the discovery of the BPH resistance genes is growing more relevant. Mudgo, a rice germplasm that is resistant to BPH, was first discovered in 1969 14 , followed in 1971 by the identification of two key BPH resistance genes, Bph1 and Bph2 . Since then, 40 genes involved in the resistance of rice to BPH have been found in the rice genome, and many of them have been cloned 15 , 16 , 17 . The mechanisms of action differ among the resistance genes. For instance, Bph14 , which is located on chromosome 12, encodes a typical CC-NB-LRR protein 18 ; Bph6 19 and Bph30 20 , which are both found on chromosome 4, encode proteins containing leucine-repeat domains; Bph3 , which was identified in the wild rice cultivar Rathu Heenati, is an OsLecRK1-OsLecRK3 tandem gene cluster that encodes G-type lectin receptor kinases localized to the plasma membrane of cells 21 . Systemic resistance to BPH was also originally present in rice without the cloned resistance genes, but during its long co-evolution with rice, BPH has overcome the effects of several originally existing resistance genes, the most notable being Bph1 and Bph2 22 , 23 . This highlights the need to identify additional planthopper resistance genes for rice resistance breeding to improve the persistence and broad spectrum of resistance to BPH.

In our previous study, using a seedbox screening method, we found a rice variety (R26) that was immune to BPH 24 ; however, the mechanism underlying the resistance to this pest remained unclear. In the current study, using RNA sequencing (RNA-seq) of the leaf sheath, we sought to delineate the differences in the transcriptomic profiles of resistant and susceptible rice varieties following feeding by BPH. Last, the function of the BPH resistance related gene ( OsREM4.1 ) was analyzed in knockout transgenic rice. This work will provide a reference for unraveling the molecular mechanism involved in the resistance of rice to insects and provide a theoretical basis for the improved breeding of BPH-resistant varieties.

Overview of the transcriptomic profiles of rice seedlings inoculated with BPH Nymphs

In previous research, using the Standard Seed Box Screening Technique, we were able to identify a new rice variety called R26 that was resistant to BPH (Fig.  1 A) 24 . However, R26 did not contain any known resistance genes, which are identifiable with gene chips if existent. When using gene chip detection, we were unable to locate resistance genes, such as Bph6 , Bph9 , Bph14 , Bph15 , Bph18 , and Bph26 . Since the material (R26) could contain a new BPH-resistance gene, transcriptomics was used to examine it.

Statistical analysis of the expressed genes, transcription factors (TFs), and differentially expressed genes (DEGs) after brown planthopper (BPH) infestation. ( A ) The phenotype of resistance of TN1 and R26 to BPH. ( B ) Line charts showing the numbers of expressed genes after BPH infestation in the TN1 and R26 rice varieties. ( C ) Venn diagram of the genes expressed in the two varieties. ( D ) The TOP10 transcription factors among the expressed genes. The numbers represent the numbers of genes in the families.

We undertook a transcriptomic analysis of TN1 (sensitive, control) and R26 (resistant, case) rice seedlings 0, 0.5, 1, 3, 5, and 7 days after inoculation with BPH (Fig.  1 B). After removing adapters and low-quality reads, a total of 244 Gb of clean data were obtained, with an average of 45.21 million reads per sample; more than 93.7% of the bases were assigned a Q score of 30 (Table S1 ). In total, 93.44–95.46% of the clean data were mapped to the reference genome. These results demonstrated that the RNA-seq data were of reliable quality. All sequencing data were uploaded to the National Center for Biotechnology Information (NCBI) (Accession ID: PRJNA1003552).

The PCA showed that the biological replicates of the two rice cultivars had good consistency, and the same material from different infection stages (time points) was clustered together, implying that the difference between the cultivars was greater than that between infection stages (Figure S1 ). The PCA further showed that the gene expression patterns related to resistance to BPH differed between the two rice varieties. The resistance of rice to BPH infection was seen to be a dynamic and complex process involving the coordinated activity of an intricate regulatory network comprising numerous genes. After infestation with BPH, the number of genes expressed in TN1 was lowest on day 1, while in the resistant variety, the number of expressed genes decreased to its lowest level after half a day (Fig.  1 B). A total of 24,367 and 23,217 genes were identified as being expressed in TN1 and R26; of these, 21,958 were co-expressed, and 1259 were expressed only in the resistant variety (Fig.  1 C). We conducted a transcription factor alignment analysis on the expressed genes and identified a total of 1891 transcription factors belonging to 56 families (Table S2). We also analyzed the transcription factors (TFs). Among these, 1891 genes were identified as TFs, which consist of 56 TF family (Table S2), and the bHLH, NACs, ERF, MYB, C2H2, and WRKY families all contained more than 100 of the expressed genes (Fig.  1 D). We analyzed the DEGs between different time points following artificial inoculation with BPH nymphs and found that the number of DEGs in the two rice cultivars first in-creased, peaking after 1 day, and subsequently decreased (Figure S2). Interestingly, the number of DEGs in TN1 was significantly higher than that in the resistant variety. Additionally, compared with day 0, TN1 exhibited the fewest DEGs on day 3, while the number of DEGs in the resistant variety decreased over time from the day of inoculation (Figure S2).

DEGs in R26 and TN1 plants before and after BPH feeding

To capture genes associated with resistance to BPH, we generated Venn diagrams of differentially expressed genes at different time points to identify genes that were induced in the resistant varieties but were differently expressed in the susceptible varieties. In this analysis, genes were identified across five time points of BPH infection. Compared with the control group, 426 and 159 genes were down-regulated and up-regulated in TN1 (Fig.  2 A and B) respectively, and 159 and 35 genes were down-regulated and up-regulated in R26 (Fig.  2 C and D). At clusters 7 and 8, some of the up-regulated genes in R26 belonged to NB-LRR family of disease-resistance genes, such as BGIOSGA033552 and BGIOSGA034264, and lignin-synthesis-related genes were also highly expressed in R26 after 1 day of infestation with BPH (BGIOSGA000512, BGIOSGA012707, and BGIOSGA036496) (Fig.  2 E). In cluster 10, an auxin-responsive protein IAA27 (BGIOSGA035021) was highly expressed (Fig.  2 E).

An overview of the transcriptomic analysis. ( A ) Venn diagram of down-regulated genes in comparison with those in TN1. ( B ) Venn diagram of up-regulated genes in comparison with those in TN1. ( C ) Venn diagram of down-regulated genes in comparison with those in R26. ( D ) Venn diagram of up-regulated genes in comparison with those in R26. ( E ) Differential gene expression analysis showing up- and down-regulated genes across all sixteen clusters.

Identification of the core genes by using WGCNA

A weighted gene co-expression network analysis (WGCNA) was performed based on the genes displaying differential abundance between TN1 and R26 over the 7 days. Beta (power) = 21 was selected as the optimal soft threshold for constructing a scale-free network (Figure S3A) and displaying network connectivity with different soft thresholds (Figure S3B) to further establish a weighted co-expression network model, classify genes, and divide them into different modules. This resulted in a total of 12 modules, each represented by a different color in Fig.  3 A. The turquoise module contained the greatest number of genes (245), and the gray module contained the smallest number (5). A correlation analysis was conducted between different BPH inoculation times and modules, and a correlation heat map was drawn (Fig.  3 B). The heat map analysis indicated that the blue module was significantly and positively correlated with CK0d (TN1 control) (0.71, 1e-06), and the green module and yellow modules were significantly correlated with CK3d (0.66, 1e-05) and CK1d (0.66, 1e-05), respectively. The magenta module was significantly correlated with CK7d (0.71, 1e-06). The red module and pink modules were significantly correlated with M0.5d (R26 infestation for 12 h) (0.63, 4e-05 and 0.52, 0.001, respectively). As can be seen in Fig.  3 B, the expression patterns of the blue, green, magenta, yellow, and red modules showed the same trends in TN1 and R26, and there was a higher correlation with TN1. The pink module showed directly opposing trends in the TN1 and R26 varieties: it was positively correlated with R26 and negatively correlated with TN1, suggesting that it may be related to resistance to BPH. The trend of gene expression in the pink module was similar to the trends in cluster 1 and cluster 3 in the MaSigpro analysis (Figure S4 and Table S3).

Gene module analysis using a weighted gene co-expression network analysis (WGCNA). ( A ) Hierarchical clustering diagram of the modules. ( B ) WGCNA of the genes with dominant expression in the two rice varieties after brown planthopper (BPH) infestation. Red indicates a positive correlation and blue indicates a negative correlation. The darker the color, the stronger the correlation. The numbers in parentheses represent significant P -values; the smaller the value, the greater the significance. ( C ) KEGG pathway analysis of the unique DEGs in the pink module. ( D ) Co-expression regulatory network analysis of the pink module.

In order to determine the probable regulatory roles of the DEGs, and thus the possible functions of the target modules, we also carried out a KEGG pathway enrichment analysis. It was discovered that 17 pathways implicated the DEGs (Fig.  3 C). Eight of the 17 pathways, such as flavonoid biosynthesis, the MAPK signaling pathway (plant), biosynthesis of other secondary metabolites, signal transduction, plant–pathogen interaction, environmental adaptation, phenylpropanoid biosynthesis, and environmental infor-mation processing, were related to the plant immune response. To gain a deeper comprehension of the resistance of R26 to BPH, a functional protein association network was generated by entering all identified genes from the pink module into the STRING database. Central to the network and associated with lignin synthesis were genes related to PAL and 4CL3 (Fig.  3 D). The central genes were functionally annotated via alignment with the rice database (Table S4). We analyzed the expression of these central genes at each dpi, which reached the peak at 12 h in R26(Figer S5). These phenomena indicate that these central genes may be the key genes for resistance to BPH.

In addition, RT-qPCR analysis of nine genes (BGIOSGA016973, BGIOSGA035600, BGIOSGA025904, BGIOSGA027799, BGIOSGA012776, BGIOSGA035957, BGIOSGA008199, BGIOSGA008200, and BGIOSGA016055) (Fig.  4 ) showed that the expression trend for the RT-qPCR results was consistent with that for the transcriptome data.

Verification of gene expression levels by using RT-qPCR. ( A – I ) The bar chart shows the expression levels of nine genes from TN1 and R26 as determined through RT-qPCR; the heat map shows the expression levels of the same genes as determined through RNA-seq analysis. The bar is the standard error of each group of processing data ( n  = 3).

Resistance of G01-8 mutants to the BPH

In order to detect whether the remorin protein plays a role in the resistance of rice to BPH, we mutated OsREM4.1 by using CRISPR/cas9 in ZH11 and found that we obtained a mutant with an additional base pair at the target position. This mutant plant was named g01-8 (Fig.  5 A). To verify the resistance of remorin to BPH, a seedling resistance analysis was performed using wild-type ZH11 plants as the control and TN1 (susceptible) and Rathu Heenati (RHT, resistant) plants as additional controls. After 7 d of BPH infes-tation, the TN1 plants died and the RHT plants survived well, while half of the ZH11 plants survived and the G01-8 plants died, thus demonstrating the effect of the OsREM4.1 gene on resistance to BPH (Fig.  5 B, C). The callose content was tested as well, the results showing that the callose content was also lowest in G01-8 plants (Fig.  5 D).

Verification of remorin-4.1-mediated resistance to BPH. ( A ) Point detection of the mutation position. ( B ) Photo showing the difference in ZH11 and G01-8 rice plants’ BPH resistance. ( C ) BPH-resistance scores of ZH11 and G01-8 plants (negatively related to BPH resistance) obtained from observations 7 days after BPH infestation ( n  = 3 independent experiments, each with 10 rice plants). ( D ) Callose content in leaf sheath of different rice plants. The bar is the standard error of each group of processing data ( n  = 3).

Schematic diagram of key potential mechanisms for regulating resistance to BPH

We created a schematic diagram to summarize the key mechanisms of the resistance of R26 rice to BPH (Fig.  6 ). When BPHs fed on rice seedlings, many biological processes were significantly affected, such as plant signaling pathways, the MAPK signaling pathway (plant), biosynthesis of other secondary metabolites, and plant–pathogen interactions. Similar to previous research results, we suggest that when the BPH feed on rice plants, they first activated plant signaling pathways, such as SA, JA, and MAPK immune cascade reactions 25 , 26 . These signaling pathways cause changes in plants’ secondary metabolic pathways, leading to the strengthening of rice cell walls. In agreement with previous findings, more secondary-metabolite-related genes were detected in R26, indicating that pathogen attacks strongly affect metabolic pathways 27 . BPH feeding can lead to calcium ion flux, trigger H 2 O 2 accumulation, and cause protein blockage, as well as callose deposition on the sieve 28 , 29 . However, in R26, in addition to initiating H 2 O 2 accumulation and causing cell death, increased remorin expression may also lead to decreased intercellular permeability, resulting in callose accumulation and increased resistance to the BPH.

Potential mechanisms of the resistance of R26 to BPH. When BPH nymphs feed on rice seedlings, resistant rice regulates a variety of biological pathways for defense, including plant hormone signal transduction, the MAPK signaling pathway, and biosynthesis of other secondary metabolites. Proteins labeled in red are genes affected and upregulated by BPH infestation.

BPH is one of the most prevalent pests endangering rice production. Cultivating rice varieties that harbor insect-resistance genes is considered the most economical, effective, environmentally friendly, and sustainable method for controlling BPH 10 . Screening resistance genes from different germplasm resources and identifying rice resistance genes against BPH are the keys to breeding insect-resistant rice varieties. Under normal circumstances, differences in gene expression are related to breed inheritance. When BPH infects rice, different resistance genes would cause different resistance reactions. We previously identified a rice variety with persistent resistance to BPH that may contain a novel resistance gene to the BPH by genomic association analysis (GWAS) 24 . In this study, for the first time, RNA expression patterns in the leaf sheath of insect-sensitive and insect-resistant rice seedlings during BPH infestation were investigated using a time-course analysis. To obtain more accurate expression data related to resistance to BPH in rice, we only selected the leaf sheaths of rice seedlings, as this is where BPH feeding is concentrated. Our data showed that, after infestation with BPH, the number of genes expressed in TN1 was higher than that expressed in the resistant variety (Fig.  1 B), and a greater number of genes were specifically expressed in TN1 than in R26 (Fig.  1 C). After 1 day of BPH feeding, the genetic changes were the largest, which was different from the results of a previous study 30 , possibly because the materials contained different resistance genes. These results suggest that when rice was not exposed to BPH, there were significant differences in the number of genes expressed between resistant and susceptible varieties, which are determined by rice genotype, and after BPH infection, the DEGs between resistant and susceptible varieties may be the reason why R26 was resistant to BPH. TFs play a regulatory role in the growth and development, secondary metabolism and stress resistance of plants. In previous research, WRKY, MYB and bZIP were significantly upregulated in resistant plant in the middle stage to increase resistance against BPH 11 , 27 , in our study, we also identified WRKYs, bZIPs and MYBs, and half of these TFs were downregulated compared with susceptible varieties, which may not be the main resistance mode in R26.

Genes are a determining factor of the phenotype, and transcriptome sequencing could offer valuable insights into the functionality of rice resistance genes to BPH infestation. Previous studies have also utilized transcriptome analysis to elucidate the mechanisms underlying resistance in different rice varieties against BPH. As BPH primarily feed on rice leaf sheaths and cause significant damage to the crop at seedling stage, this study employed transcriptomic analysis on the leaf sheaths of “TN1” and “R26” with BPH infestation to unveil their resistance mechanisms. Basic resistance exists in both susceptible and resistant rice varieties. Feeding by herbivores can promote the expression of the PLD gene and the release of volatiles from green leaves, while resistance to BPH can be restored through the application of volatiles to green leaves 31 , 32 . In addition, BPH infestation was also reported to activate MAPK-, ethylene-, and SA-related signaling pathways 18 , 25 . Here, the DEGs between the TN1 and R26 varieties were mainly associated with “phenylalanine, tyrosine, and tryptophan biosynthesis”, “biosynthesis of other secondary metabolites”, and “MAPK signaling pathway (plant)” in the modules assessed in the WGCNA. In addition to inducing the production of metabolites for resistance, pests also induce the production of defensive proteins, which are usually enzymes, such as phenylalanine ammonialyase (PAL), peroxidase (PO), and polyphenol oxidase (PPO). PAL is an important enzyme that acts as a link between plant birth metabolism and secondary metabolism, and plays an important role in plants. It can regulate the resistance to BPH by regulating the biosynthesis and accumulation of SA and lignin 33 . After BPHs fed on rice plants, the PAL activity in the resistant rice variety was significantly higher than that in susceptible rice 34 , which was consistent with our experimental results of increases in the gene expression of defense-related secondary metabolites such as PAL resistant rice, and the inhibition of BPH infestation by the high expression of protease inhibitors. In addition, the 4CL was the main downstream target of the PAL pathway, catalyzing the final step to the formation of various cinnamate CoA sulphoids and controlling the pathway into the metabolism of different phenylpropanoid compounds. 4CL used cinnamic acid and its hydroxyl or methoxy derivatives such as 4-coumaric acid, ferulic acid, erucic acid as substrate to produce the corresponding coenzyme A ester. 4CL was also one of the rate-limiting enzymes in lignin synthesis, which it regulated. In this study, through WGCNA analysis, we found that PAL , 4CL3 , and 4CL5 were the hub genes of R26 resistance to BPH infection, which may be caused by the BPH infection resulting in increased vanillin synthesis in resistant rice. plants containing vanillin have strong insecticidal and repellent activities 35 , 36 , 37 , making R26 resistant to BPH. Additionally, we found that after 12 h of BPH infestation, the expression of these genes in the resistant rice variety R26 was significantly increased, implying that they were involved in the process of resistance to the pest. In summary, the RNA-seq results indicated that the immune differences between the TN1 and R26 varieties stimulated by BPH infection, such as those involving the MAPK, lignin synthesis, and metabolism-related pathways, are variety-specific. The responses of resistance genes are faster in resistant rice varieties than in susceptible ones, and this helps protect plants against BPH attacks and keeps them alive longer.

Plant hormones play important roles in plant resistance to insects and pathogens. Studies have shown that auxin is crucial to plant growth and development, as well as in plant–pathogen interactions 38 . Rice containing Bph14 showed an increase in the expression levels of salicylic acid (SA) related genes ( EDS1 , PAD , and ICS1 ) after feeding by BPH, while the expression levels of jasmonic acid (JA) and ethylene signaling pathway genes decreased 18 . After feeding on materials containing the Bph6 gene by BPH, genes related to salicylic acid (SA), jasmonic acid (JA), and gibberellin (CKs) were upregulated, and the response speed was faster than that of susceptible varieties 19 . In our study, we also found that in resistant varieties, hormones quickly respond to feeding by the BPH, while in susceptible varieties, the response speed is slower. In this study, we found that plant hormone signal transduction pathways were enriched in the brown module and identified IAA1 as the hub gene. IAA1 (BGIOSGA002262) expression levels were lowest in the resistant variety 1 day after exposure to BPH; this result was similar to previous single-cell sequencing results 9 . Moreover, it was found that auxin can inhibit PR1 expression, IAA1 may be related to insect resistance in resistant varieties, and the antagonism between IAA1 and SA may represent a balance between plant growth and defense 39 , 40 . Studies have shown that ABA is a negative regulator associated with plant disease resistance. However, ABA also has a positive effect on resistance to plant diseases. ABA enhances plant resistance to pathogens through mechanisms that include callose deposition and the thickening of callose in the cell wall to form the corpus callosum 41 . The remorin protein is the main component of the plasma membrane and intercellular desmosis, and participates in the interaction of plant hormones to improve plant disease resistance. It can regulate its temporal and spatial expression in the plasma membrane through phosphorylation, and it can induce callose to regulate cytodesmosis closure, which can effectively limit the intercellular movement and proliferation of PVX virus 42 . By knocking out the rice OsREM4.1 gene, we found that it was more susceptible to BPH than the wild type was (Fig.  6 ). it is possible that OsREM4.1 mutation causes callus failure to accumulate and reduces rice resistance to BPH. The results indicate that OsREM4.1 plays a role in rice resistance to BPH by regulating callose accumulation, and may provide attachment medium for other anti-insect compounds; the molecular mechanism needs further study. The results of this study will be helpful for the early screening and molecular marker-assisted breeding of rice varieties resistant to BPH.

Plant materials and insect populations

The rice varieties used in this study were the susceptible variety TN1 and the insect-resistant variety R26 identified in our previous study 24 . Seeds were provided by the Rice Research Institute, Fujian Academy of Agricultural Sciences (Fuzhou, China). The rice seeds were soaked at 26 °C for 48 h, exposed, and sown in seedling trays (40 × 30 × 8 cm) containing paddy soil. The seedling trays were evenly divided into 10 rows with 12 seedlings per row, two varieties in alternate rows, and three biological replicates per variety. The seedlings were grown in a greenhouse for 7 days (28℃, 14 h/10 h light/dark photoperiod). The BPH-resistance genes were detected at the Wuhan Greenfafa Institute of Novel Genechip R&D Co., Ltd (Greenfafa, Wuhan, China) using an Illumina SLYm1R SNP chip containing 31,753 SNPs, and the chromosomal locations of each probe on the SLYm1r SNP chip were determined by using the Nipponbare MSU7.0 as a reference genome.

Plant infestation with BPH and sample collection

BPH specimens were provided by the Rice Research Institute, Fujian Academy of Agricultural Sciences (Fuzhou, China). BPH feeding was performed as previously described 24 . The BPH specimens were reared on TN1 in the greenhouse at a temperature of 26 ± 2 °C and a relative humidity of 65 ± 5% with a 14 h/10 h light/dark photoperiod (artificial lighting). Three trays containing 10-day-old seedlings were covered with insect-proof nets, and the seedlings of both varieties were artificially inoculated, with 8–10 nymphs of 1–2 instar BPHs per seedling. Leaf sheaths fed by the BPHs that showed consistent growth were collected at 0, 0.5, 1, 3, 5, and 7 days after infestation. A total of 36 samples were collected, including three biological replicates. The stems were immediately placed in liquid nitrogen and stored at − 80 °C for subsequent RNA extraction.

RNA extraction and transcriptome sequencing

Total RNA was isolated by using Trizol reagent (Invitrogen Life Technologies), after which the RNA concentration, quality, and integrity were determined by a NanoDrop spectrophotometer (Thermo Scientific). Three micrograms of RNA was used as the input material for RNA sample preparation. The prepared RNA libraries were sequenced on the NovaSeq 6000 platform (Illumina) by Shanghai Personal Biotechnology Co., Ltd. Adapters and low-quality reads were filtered out by using Cutadapt (v1.15), yielding high-quality, clean data for further analysis. The clean data were aligned with the rice reference genome ( Oryza sativa indica, ASM465v1; http://plants.ensembl.org/Oryza_indica/Info/Index ) using Hisat2 (v2.0.5) 43 . The original expression of the genes was compared with the read count for each gene by using HTSeq (0.9.1). Gene expression was then normalized based on fragments per kilobase of exon per million fragments mapped (FPKM) reads. Genes with FPKM > 1 were considered to be expressed. Differentially expressed genes (DEGs) were identified using DESeq (version 1.30.0) with |log2FoldChange|>1 and a P-value of < 0.05 as the threshold. MaSigPro (version 1.64.0) 44 was employed for time-course analysis. The gene expression matrix for all of the samples was input into MaSigPro with the susceptible rice variety (TN1) as the control check. Then, the design matrix was constructed based on the two rice varieties and six developmental time points. The degree of polynomial regression was set to 9, and the forward elimination algorithm was used for stepwise regression, with R 2  > 0.9 as the threshold; the significantly fitting genes were differentially expressed over time between the two varieties. Hierarchical clustering (hclust) was performed based on the correlation coefficient distance.

All of the genes were mapped to terms in the Gene Ontology (GO) database, and the number of differentially enriched genes for each term was calculated. The topGO package was used to analyze the GO term enrichment for the DEGs, and the hypergeometric distribution method was used to calculate the P-value (enrichment P-value: <0.05). The main biological functions of the differentially abundant genes were determined based on the identified significantly enriched GO terms associated with the DEGs. The TBtools (version 1.120) 45 software was used for a KEGG pathway enrichment analysis ( P  < 0.05) of the DEGs.

Weighted gene co-expression network analysis

Gene co-expression networks were analyzed by using the WGCNA (version 1.72) package in R 46 . The co-expression modules were obtained by the automatic network construction and module detection function (blockwiseModules) with the following default parameters: soft threshold power = 10, TOMtype = signed, mergeCutHeight = 0.25, and minModuleSize = 30. Protein interactions were predicted using the STRING database. The hub genes were selected and visualized with Cytoscape (version 3.9.1).

Construction of the REM4.1 mutant and BPH resistance evaluation

The OsREM4.1 mutant was created using CRISPR/Cas9 editing technology, and the target sequence for the mutation was 5’-CGTCGTCGTCGTACCACCGGCGG-3’. Additionally, ZH11 rice was utilized to create the mutant. R: TTGTTGACCTTGGCGACCTC and F: CAAACGGCGGCTAGTGGTAG were the mutant detection primers. Additionally, the previously established approach to evaluating the phenotypic resistance of rice that was variably resistant to BPH was used 24 . The callose content was determined with plant callose ELISA kit.

Quantitative real-time PCR analysis and data statistical analysis

Total RNA was extracted as described for RNA sequencing (Sect. 2.3). The isolated RNA was reverse-transcribed to cDNA using the RT First Strand cDNA Synthesis Kit (Servicebio, G3330). qPCR was conducted on a CFX Connect (Bio-Rad). Each run had three biological replicates and three technical replicates. Primers were designed using Primer Premier 5 (Table S5). The relative expression levels of each gene were calculated by using the 2 -ΔΔCt method, with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the reference gene.

The statistical calculations and histogram drawing of experimental data were performed using Graphad Prism 7. Statistical analyses were performed using one-way ANOVA or Student’s t tests, and p-values < 0.05 were considered to indicate statistical significance.

Data availability

All sequence data of the samples are available on the website of the NCBI SRA (Sequence Read Archive) database (accession number: PRJNA1003552).

Cheng, X., Zhu, L. & He, G. Towards understanding of molecular interactions between rice and the brown planthopper. Mol. Plant. 6 , 621–634. https://doi.org/10.1093/mp/sst030 (2013).

Article   CAS   PubMed   Google Scholar  

Xue, J. et al. Transcriptome analysis of the brown planthopper Nilaparvata lugens. PLoS One . 5 , e14233. https://doi.org/10.1371/journal.pone.0014233 (2010).

Article   ADS   CAS   PubMed   PubMed Central   Google Scholar  

Muhammad, S. et al. Pesticide application has little influence on coding and non-coding gene expressions in rice. BMC Genom. 20 , 1009. https://doi.org/10.1186/s12864-019-6381-y (2019).

Article   CAS   Google Scholar  

Lou, Y. & Cheng, J. -a. basic research on the outbreak mechanism and sustainable management of rice planthoppers (in Chinese). Chin. J. Appl. Entomol. 48 , 8 (2011).

Google Scholar  

Tanaka, K., Endo, S. & Kazano, H. Toxicity of insecticides to predators of rice planthoppers: spiders, the mirid bug and the dryinid wasp. Appl. Entomol. Zool. 35 (1), 177–187. https://doi.org/10.1303/aez.2000.177 (2000).

Yue, L., Kang, K. & Zhang, W. Metabolic responses of brown planthoppers to IR56 resistant rice cultivar containing multiple resistance genes. J. Insect Physiol. 113 , 67–76. https://doi.org/10.1016/j.jinsphys.2018.10.001 (2019).

Li, Z. et al. High-resolution mapping and breeding application of a novel brown planthopper resistance gene derived from wild rice (Oryza. Rufipogon Griff). Rice (N Y) . 12 , 41. https://doi.org/10.1186/s12284-019-0289-7 (2019).

Article   PubMed   Google Scholar  

Guan, W. et al. Bulked segregant RNA sequencing revealed difference between virulent and avirulent brown planthoppers. Front. Plant. Sci. 13 , 843227. https://doi.org/10.3389/fpls.2022.843227 (2022).

Article   PubMed   PubMed Central   Google Scholar  

Zha, W. et al. Single-cell RNA sequencing of leaf sheath cells reveals the mechanism of rice resistance to brown planthopper (Nilaparvata lugens). Front. Plant. Sci. 14 , 1200014. https://doi.org/10.3389/fpls.2023.1200014 (2023).

Zhang, Q. et al. Transcriptome and metabolome profiling reveal the Resistance mechanisms of Rice against Brown Planthopper. Int. J. Mol. Sci. 23 https://doi.org/10.3390/ijms23084083 (2022).

Satturu, V. et al. RNA-Seq based global transcriptome analysis of rice unravels the key players associated with brown planthopper resistance. Int. J. Biol. Macromol. 191 , 118–128. https://doi.org/10.1016/j.ijbiomac.2021.09.058 (2021).

Hao, P. et al. Herbivore-induced callose deposition on the sieve plates of rice: an important mechanism for host resistance. Plant. Physiol. 146 , 1810–1820. https://doi.org/10.1104/pp.107.111484 (2008).

Article   CAS   PubMed   PubMed Central   Google Scholar  

Liu, J. et al. Mechanisms of callose deposition in rice regulated by exogenous abscisic acid and its involvement in rice resistance to Nilaparvata lugens Stål (Hemiptera: Delphacidae). Pest Manag Sci. 73 , 2559–2568. https://doi.org/10.1002/ps.4655 (2017).

Article   ADS   CAS   PubMed   Google Scholar  

Pathak, M. D., Cheng, C. H. & Fortuno, M. E. Resistance to Nephotettix impicticeps and Nilaparvata lugens in varieties of Rice. Nature . 223 , 502–504. https://doi.org/10.1038/223502a0 (1969).

Article   ADS   Google Scholar  

Buna, W. et al. Mapping of two new brown planthopper resistance genes from wild rice. Chin. Sci. Bull. 46 , 1092–1095. https://doi.org/10.1007/BF02900685 (2001).

Article   Google Scholar  

Huang, Z., He, G., Shu, L., Li, X. & Zhang, Q. Identification and mapping of two brown planthopper resistance genes in rice. Theor. Appl. Genet. 102 , 929–934. https://doi.org/10.1007/s001220000455 (2001).

Jing, S. et al. Genomics of interaction between the brown planthopper and rice. Curr. Opin. Insect Sci. 19 , 82–87. https://doi.org/10.1016/j.cois.2017.03.005 (2017).

Du, B. et al. Identification and characterization of Bph14, a gene conferring resistance to brown planthopper in rice. Proc. Natl. Acad. Sci. U S A . 106 , 22163–22168. https://doi.org/10.1073/pnas.0912139106 (2009).

Article   ADS   PubMed   PubMed Central   Google Scholar  

Guo, J. et al. Bph6 encodes an exocyst-localized protein and confers broad resistance to planthoppers in rice. Nat. Genet. 50 , 297–306. https://doi.org/10.1038/s41588-018-0039-6 (2018).

Shi, S. et al. Bph30 confers resistance to brown planthopper by fortifying sclerenchyma in rice leaf sheaths. Mol. Plant. 14 , 1714–1732. https://doi.org/10.1016/j.molp.2021.07.004 (2021).

Liu, Y. et al. A gene cluster encoding lectin receptor kinases confers broad-spectrum and durable insect resistance in rice. Nat. Biotechnol. 33 , 301–305. https://doi.org/10.1038/nbt.3069 (2015).

Cohen, M. B., Alam, S. N., Medina, E. B. & Bernal, C. C. Brown planthopper, Nilaparvata lugens, resistance in rice cultivar IR64: mechanism and role in successful N. lugens management in Central Luzon, Philippines. Entomol. Exp. Appl. 85 , 221–229. https://doi.org/10.1046/j.1570-7458.1997.00252.x (1997).

Alam, S. N. & Cohen, M. B. Durability of brown planthopper, Nilaparvata lugens, resistance in rice variety IR64 in greenhouse selection studies. Entomol. Exp. Appl. 89 , 71–78. https://doi.org/10.1046/j.1570-7458.1998.00383.x (1998).

Shi, L. et al. Genome-wide Association Study reveals a new quantitative trait Locus in Rice related to resistance to Brown Planthopper Nilaparvata lugens (Stal). Insects . 12 https://doi.org/10.3390/insects12090836 (2021).

Hu, J. et al. The Bphi008a gene interacts with the ethylene pathway and transcriptionally regulates MAPK genes in the response of rice to brown planthopper feeding. Plant. Physiol. 156 , 856–872. https://doi.org/10.1104/pp.111.174334 (2011).

Lu, J. et al. An EAR-motif-containing ERF transcription factor affects herbivore-induced signaling, defense and resistance in rice. Plant. J. 68 , 583–596. https://doi.org/10.1111/j.1365-313X.2011.04709.x (2011).

Xue, Y. et al. Comparative transcriptome-wide identification and differential expression of genes and lncRNAs in rice near-isogenic line (KW-Bph36-NIL) in response to BPH feeding. Front. Plant. Sci. 13 , 1095602. https://doi.org/10.3389/fpls.2022.1095602 (2022).

Bonaventure, G. Perception of insect feeding by plants. Plant. Biol. (Stuttg) . 14 , 872–880. https://doi.org/10.1111/j.1438-8677.2012.00650.x (2012).

Zhou, G. et al. Silencing OsHI-LOX makes rice more susceptible to chewing herbivores, but enhances resistance to a phloem feeder. Plant. J. 60 , 638–648. https://doi.org/10.1111/j.1365-313X.2009.03988.x (2009).

Tan, J. et al. A combined microRNA and transcriptome analyses illuminates the resistance response of rice against brown planthopper. BMC Genom. 21 , 144. https://doi.org/10.1186/s12864-020-6556-6 (2020).

Qi, J. et al. The chloroplast-localized phospholipases D α4 and α5 regulate herbivore-induced direct and indirect defenses in rice. Plant. Physiol. 157 , 1987–1999. https://doi.org/10.1104/pp.111.183749 (2011).

Guo, J. et al. The Asian corn borer Ostrinia furnacalis feeding increases the direct and indirect defence of mid-whorl stage commercial maize in the field. Plant. Biotechnol. J. 17 , 88–102. https://doi.org/10.1111/pbi.12949 (2019).

He, J. et al. An R2R3 MYB transcription factor confers brown planthopper resistance by regulating the phenylalanine ammonia-lyase pathway in rice. Proc. Natl. Acad. Sci. U S A . 117 , 271–277. https://doi.org/10.1073/pnas.1902771116 (2020).

Alagar, M., Suresh, S., Saravanakumar, D. & Samiyappan, R. Feeding-induced changes in defence enzymes and PR proteins and their implications in host resistance to Nilaparvata lugens. J. Appl. Entomol. 134 , 123–131. https://doi.org/10.1111/j.1439-0418.2009.01461.x (2010).

Kim, S. I. et al. Toxicity and synergic repellency of plant essential oil mixtures with vanillin against Aedes aegypti (Diptera: Culicidae). J. Med. Entomol. 49 , 876–885. https://doi.org/10.1603/me11127 (2012).

Songkro, S. et al. Effects of glucam P-20, vanillin, and fixolide on mosquito repellency of citronella oil lotions. J. Med. Entomol. 49 , 672–677. https://doi.org/10.1603/me11141 (2012).

Kletskova, A. V., Potkin, V. I., Dikusar, E. A. & Zolotar, R. M. New Data on Vanillin-based Isothiazolic Insecticide synergists. Nat. Prod. Commun. 12 , 105–106 (2017).

PubMed   Google Scholar  

Pandey, S. P. et al. Simulated herbivory in chickpea causes rapid changes in defense pathways and hormonal transcription networks of JA/ethylene/GA/auxin within minutes of wounding. Sci. Rep. 7 , 44729. https://doi.org/10.1038/srep44729 (2017).

Wang, D., Pajerowska-Mukhtar, K., Culler, A. H. & Dong, X. Salicylic acid inhibits pathogen growth in plants through repression of the auxin signaling pathway. Curr. Biol. 17 , 1784–1790. https://doi.org/10.1016/j.cub.2007.09.025 (2007).

Ye, J. et al. The Auxin-regulated protein ZmAuxRP1 coordinates the balance between Root Growth and Stalk rot Disease Resistance in Maize. Mol. Plant. 12 , 360–373. https://doi.org/10.1016/j.molp.2018.10.005 (2019).

Oide, S. et al. A novel role of PR2 in abscisic acid (ABA) mediated, pathogen-induced callose deposition in Arabidopsis thaliana. New. Phytol . 200 , 1187–1199. https://doi.org/10.1111/nph.12436 (2013).

Perraki, A. et al. REM1.3’s phospho-status defines its plasma membrane nanodomain organization and activity in restricting PVX cell-to-cell movement. PLoS Pathog . 14 , e1007378. https://doi.org/10.1371/journal.ppat.1007378 (2018).

Kim, D., Langmead, B. & Salzberg, S. L. HISAT: a fast spliced aligner with low memory requirements. Nat. Methods . 12 , 357–360. https://doi.org/10.1038/nmeth.3317 (2015).

Conesa, A., Nueda, M. J., Ferrer, A. & Talón, M. maSigPro: a method to identify significantly differential expression profiles in time-course microarray experiments. Bioinformatics . 22 , 1096–1102. https://doi.org/10.1093/bioinformatics/btl056 (2006).

Chen, C. et al. TBtools: an integrative Toolkit developed for interactive analyses of big Biological Data. Mol. Plant. 13 , 1194–1202. https://doi.org/10.1016/j.molp.2020.06.009 (2020).

Langfelder, P. & Horvath, S. WGCNA: an R package for weighted correlation network analysis. BMC Bioinform. 9 , 559. https://doi.org/10.1186/1471-2105-9-559 (2008).

Download references

Acknowledgements

This research was funded by the National Natural Science Foundation of China (32202591), the Special Foundation of Nonprofit Research Institutes of Fujian Province (2022R1023005), and the Natural Science Foundation of Fujian Province of China (2022J01449).

Author information

Meng Dong and Chunzhu Wu contributed equally to this work.

Authors and Affiliations

Rice Research Institute of Fujian Academy of Agricultural Sciences, Cangshan, Fuzhou, 350018, China

Meng Dong, Chunzhu Wu, Ling Lian, Longqing Shi, Zhenxing Xie, Junian Zhang & Zhaowei Jiang

You can also search for this author in PubMed   Google Scholar

Contributions

M.D., C.W., L.L., and Z.J. conceived and designed the experiments. M.D. conducted most of the experiments. M.D., L.L., and L.S. analyzed the data and wrote or reviewed the draft of the article. Z.X. and J.Z. helped collect the samples. All authors have read and agreed to the published version of the manuscript.

Corresponding author

Correspondence to Zhaowei Jiang .

Ethics declarations

Competing interests.

The authors declare no competing interests.

Ethics approval and consent to participate

The plant in this study were grown in greenhourse of Rice Research Institute of Fujian Academy of Agricultural Sciences, Fuzhou, China. The research conducted neither required approval from an ethics committee, nor involved any human or animal subjects in this study. No specific permits were required for the described field studies. We complied with the IUCN Policy Statement on Research Involving Species at Risk of Extinction and the Convention on the Trade in Endangered Species of Wild Fauna and Flora.

Additional information

Publisher’s note.

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Rights and permissions.

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/ .

Reprints and permissions

About this article

Cite this article.

Dong, M., Wu, C., Lian, L. et al. A time-course transcriptomic analysis reveals the key responses of a resistant rice cultivar to brown planthopper infestation. Sci Rep 14 , 22455 (2024). https://doi.org/10.1038/s41598-024-73546-x

Download citation

Received : 27 February 2024

Accepted : 18 September 2024

Published : 28 September 2024

DOI : https://doi.org/10.1038/s41598-024-73546-x

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

• Oryza sativa L.
• Brown planthopper
• Leaf sheath

By submitting a comment you agree to abide by our Terms and Community Guidelines . If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Quick links

• Explore articles by subject
• Guide to authors
• Editorial policies

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

Rice. Half of Humanity Eats It. And Climate Change Is Wrecking It.

By Somini Sengupta May 20, 2023

• Share full article

Half of humanity eats it.

Climate change is wrecking it.

And around the world, people are finding creative new ways to grow it.

Rice Gets Reimagined, From the Mississippi to the Mekong

By Somini Sengupta , reporting from Arkansas and Bangladesh, and Tran Le Thuy , from Vietnam. Thanh Nguyen photographed in Vietnam and Rory Doyle in Arkansas.

May 20, 2023

Rice is in trouble as the Earth heats up, threatening the food and livelihood of billions of people. Sometimes there’s not enough rain when seedlings need water, or too much when the plants need to keep their heads above water. As the sea intrudes, salt ruins the crop. As nights warm, yields go down.

These hazards are forcing the world to find new ways to grow one of its most important crops. Rice farmers are shifting their planting calendars. Plant breeders are working on seeds to withstand high temperatures or salty soils. Hardy heirloom varieties are being resurrected.

And where water is running low, as it is in so many parts of the world, farmers are letting their fields dry out on purpose, a strategy that also reduces methane, a potent greenhouse gas that rises from paddy fields.

The climate crisis is particularly distressing for small farmers with little land, which is the case for hundreds of millions of farmers in Asia. “They have to adapt,” said Pham Tan Dao, the irrigation chief for Soc Trang, a coastal province in Vietnam, one of the biggest rice-producing countries in the world. “Otherwise they can’t live.”

In China, a study found that extreme rainfall had reduced rice yields over the past 20 years. India limited rice exports out of concern for having enough to feed its own people. In Pakistan, heat and floods destroyed harvests, while in California, a long drought led many farmers to fallow their fields.

Worldwide, rice production is projected to shrink this year, largely because of extreme weather.

Today, Vietnam is preparing to take nearly 250,000 acres of land in the Mekong Delta, its rice bowl, out of production. Climate change is partly to blame, but also dams upstream on the Mekong River that choke the flow of freshwater. Some years, when the rains are paltry, rice farmers don’t even plant a third rice crop, as they had before, or they switch to shrimp, which is costly and can degrade the land further.

The challenges now are different from those 50 years ago. Then, the world needed to produce much more rice to stave off famine. High-yielding hybrid seeds, grown with chemical fertilizers, helped. In the Mekong Delta, farmers went on to produce as many as three harvests a year, feeding millions at home and abroad.

Today, that very system of intensive production has created new problems worldwide. It has depleted aquifers, driven up fertilizer use, reduced the diversity of rice breeds that are planted, and polluted the air with the smoke of burning rice stubble. On top of that, there’s climate change: It has upended the rhythm of sunshine and rain that rice depends on.

Perhaps most worrying, because rice is eaten every day by some of the world’s poorest, elevated carbon dioxide concentrations in the atmosphere deplete nutrients from each grain.

Rice faces another climate problem. It accounts for an estimated 8 percent of all global methane emissions from human activity. That’s a fraction of the emissions from coal, oil and gas, which together account for 35 percent of methane emissions. But fossil fuels can be replaced by other energy sources. Rice, not so much. Rice is the staple grain for an estimated three billion people. It is biryani and pho, jollof and jambalaya — a source of tradition, and sustenance.

“We are in a fundamentally different moment,” said Lewis H. Ziska, a professor of environmental health sciences at Columbia University. “It’s a question of producing more with less. How do you do that in a way that’s sustainable? How do you do that in a climate that’s changing?”

A risky balance: Rice, or shrimp?

In 1975, facing famine after war, Vietnam resolved to grow more rice.

It succeeded spectacularly, eventually becoming the world’s third-largest rice exporter after India and Thailand. The green patchwork of the Mekong Delta became its most prized rice region.

At the same time, though, the Mekong River was reshaped by human hands.

Starting in southeastern China, the river meanders through Myanmar, Laos, Thailand and Cambodia, interrupted by many dams. Today, by the time it reaches Vietnam, there is little freshwater left to flush out seawater seeping inland. Rising sea levels bring in more seawater. Irrigation canals turn salty. The problem is only going to get worse as temperatures rise.

“We now accept that fast-rising salty water is normal,” said Mr. Pham, the irrigation chief. “We have to prepare to deal with it.” Where saltwater used to intrude 30 kilometers or so (about 19 miles) during the dry season, he said, it can now reach 70 kilometers inland.

Climate change brings other risks. You can no longer count on the monsoon season to start in May, as before. And so in dry years, farmers now rush to sow rice 10 to 30 days earlier than usual, researchers have found . In coastal areas, many rotate between rice and shrimp, which like a bit of saltwater.

But this requires reining in greed, said Dang Thanh Sang, 60, a lifelong rice farmer in Soc Trang. Shrimp bring in high profits, but also high risks. Disease sets in easily. The land becomes barren. He has seen it happen to other farmers.

So, on his seven acres, Mr. Dang plants rice when there’s freshwater in the canals, and shrimp when seawater seeps in. Rice cleans the water. Shrimp nourishes the soil. “It’s not a lot of money like growing only shrimp,” he said. “But it’s safer.”

Elsewhere, farmers will have to shift their calendars for rice and other staple grains, researchers concluded in a recent paper . Scientists are already trying to help them.

Secrets of ancient rice

The cabinet of wonders in Argelia Lorence’s laboratory is filled with seeds of rice — 310 different kinds of rice.

Many are ancient, rarely grown now. But they hold genetic superpowers that Dr. Lorence, a plant biochemist at Arkansas State University, is trying to find, particularly those that enable rice plants to survive hot nights, one of the most acute hazards of climate change. She has found two such genes so far. They can be used to breed new hybrid varieties.

“I am convinced,” she said, “that decades from now, farmers are going to need very different kinds of seeds.”

Dr. Lorence is among an army of rice breeders developing new varieties for a hotter planet. Multinational seed companies are heavily invested. RiceTec, from which most rice growers in the southeastern United States buy seeds, backs Dr. Lorence’s research.

Critics say hybrid seeds and the chemical fertilizers they need make farmers heavily dependent on the companies’ products, and because they promise high yields, effectively wipe out heirloom varieties that can be more resilient to climate hazards.

The new frontier of rice research involves Crispr, a gene-editing technology that U.S. scientists are using to create a seed that produces virtually no methane. (Genetically modified rice remains controversial, and only a handful of countries allow its cultivation.)

In Bangladesh, researchers have produced new varieties for the climate pressures that farmers are dealing with already. Some can grow when they’re submerged in floodwaters for a few days.

Others can grow in soils that have turned salty. In the future, researchers say, the country will need new rice varieties that can grow with less fertilizer, which is now heavily subsidized by the state. Or that must tolerate even higher salinity levels.

No matter what happens with the climate, said Khandakar M. Iftekharuddaula, chief scientific officer at the Bangladesh Rice Research Institute, Bangladesh will need to produce more. Rice is eaten at every meal. “Rice security is synonymous with food security,” he said.

Less watery rice paddies?

Rice is central to the story of the United States. It enriched the coastal states of the American South, all with the labor of enslaved Africans who brought with them generations of rice-growing knowledge.

Today, the country’s dominant rice-growing area is spread across the hard clay soil near where the Mississippi River meets one of its tributaries, the Arkansas River. It looks nothing like the Mekong Delta. The fields here are laser-leveled flat as pancakes. Work is done by machine. Farms are vast, sometimes more than 20,000 acres.

What they share are the hazards of climate change. Nights are hotter. Rains are erratic. And there’s the problem created by the very success of so much intensive rice farming: Groundwater is running dangerously low.

Enter Benjamin Runkle, an engineering professor from the University of Arkansas at Fayetteville. Instead of keeping rice fields flooded at all times, as growers have always done, Dr. Runkle suggested that Arkansas farmers let the fields dry out a bit, then let in the water again, then repeat. Oh, and would they let him measure the methane coming off their fields?

Mark Isbell, a second-generation rice farmer, signed up.

On the edge of Mr. Isbell’s field, Dr. Runkle erected a tall white contraption that an egret might mistake for a cousin. The device measured the gases produced by bacteria stewing in the flooded fields. “It’s like taking a breathalyzer test of the land,” Dr. Runkle said.

His experiment, carried out over seven years, concluded that by not flooding the fields continuously, farmers can reduce rice methane emissions by more than 60 percent .

Other farmers have taken to planting rice in rows, like corn, and leaving furrows in between for the water to flow. That, too, reduces water use and, according to research in China, where it’s been common for some time, cuts methane emissions.

The most important finding, from Mr. Isbell’s vantage point: It reduces his energy bills to pump water. “There are upsides to it beyond the climate benefits,” he said.

By cutting his methane emissions, Mr. Isbell was also able to pick up some cash by selling “carbon credits,” which is when polluting businesses pay someone else to make emissions cuts.

When neighbors asked him how that went, he told them he could buy them a drink and explain. “But it will have to be one drink,” he said. He made very little money from it.

However, there will be more upsides soon. For farmers who can demonstrate emissions reductions, the Biden administration is offering federal funds for what it calls “climate smart” projects. Agriculture Secretary Tom Vilsack came to Mr. Isbell’s farm last fall to promote the program. Mr. Isbell reckons the incentives will persuade other rice growers to adopt alternate wetting and drying.

“We kind of look over the hill and see what’s coming for the future, and learn now,” said his father, Chris Isbell.

Advertisement

17 Creative Ways To Use Rice Paper In Your Cooking

The continent of Asia is home to some of the world's best cuisines. From the savory sauces of Southeast Asia to the innovative use of soybeans in East Asia and beyond, the culinary history of the land goes back millennia. One handy contribution from Asian cuisine is edible rice paper, which is especially widespread in Vietnam, where it's called bánh tráng. Rice paper is typically made from rice and tapioca starch, water, and salt, and commonly used as edible wrapping for spring rolls and dumplings. 

Beyond those uses, with creativity, rice paper can be used for so much more. Its versatility stems from its neutral flavor and texture, which becomes bendable, stretchy, and easy to manipulate when soaked in water. Skip the scramble and start the day with a rice paper omelet. Make a vegan BLT with rice paper bacon. Those are just two of many creative ways to amp up your cooking with rice paper. 

Transform rice paper into tteokbokki

No matter where you travel, trying street food is one of the best ways to experience the local cuisine and culture. In South Korea, spicy tteokbokki is one of the most popular street foods around. It's a simple dish that consists of cylindrical rice cakes that are stir-fried with sweet-and-spicy tteokbokki sauce, which gets its piquant kick from Korean chili paste. At a glance, it resembles penne pasta, but rather than being hollow and tubular, the rice cakes are dense and chewy.

Tteokbokki can be found at Korean restaurants, and rice cakes are widely available at Asian supermarkets. If you happen to live in a city without those options, you can still experience this crave-worthy Korean street food classic. The  rice paper hack for your homemade tteokbokki  starts by softening rice paper with water. Once pliable, roll each sheet into thin tubes and slice them into short pieces. Next, cook the rice paper "cakes" in a pan with tteokbokki sauce for a few minutes, and voilà, enjoy your homemade rice paper treat. 

Create fusion cuisine with rice paper pizza

In the debate over which cuisines are the best, Chinese and Italian are mainstays. Although the latter often holds the top spot, broth-flavored noodles are just as smile-inducing as sauce-smothered pasta. When faced with such a challenging decision, sometimes the best solution is culinary fusion. Rice paper is an unlikely bridge between both culinary realms, as it can be used as a low-carb alternative to pizza crust.

Rice paper pizza, also known as Vietnamese pizza, is a popular street food called bánh tráng nướng in Vietnam, where vendors grill rice paper sheets over charcoal. These sheets are traditionally topped with eggs, scallions, shrimp, sausage, sriracha, and more. While you can attempt to make an authentic version of Vietnamese pizza, you can also swap the traditional ingredients with your favorite pizza toppings on a sheet of rice paper, and then bake, grill, or fry it. Unlike pizza dough, rice paper is neutral-flavored, and a more direct vehicle for delivering tastiness into your muncher. It's a low-maintenance snack that'll surely satisfy your pizza fix.

Start your day with a rice paper omelet

From savory scrambles to flavorful frittatas , eggs are one of the most dynamic and nutrient-packed foods around. When it comes to egg-based breakfasts, omelets arguably reign supreme. They incorporate elements from scrambles and frittatas, which makes them poultry-provided perfection.

That said, as amazing as traditional omelets are, your mornings will never be the same after you try rice paper omelets, which are something of a variation on Vietnamese pizza. You only need eggs, a rice paper wrapper, your choice of protein and other fillings, salt, and cooking oil. Start by beating the egg yolk in a bowl and preparing your ingredients. Pull out your go-to frying pan, add a bit of oil, and place a sheet of rice paper inside. Next, distribute your diced ingredients atop the rice paper, followed by your egg yolk. Once it has a solidified consistency, fold it like a regular omelet and put it on a plate to enjoy. 

Make crispy ramen rice paper wraps

There's nothing like a chewy, crispy, and tasty treat to quell your munchie monster, and when you don't need utensils, it's even better. One type of finger food that's sure to get you salivating is rice-paper-wrapped ramen. Although ramen purists may scoff at the idea, this no-frills snack not only satisfies, but can be enjoyed on the go as well. Rice paper-wrapped ramen is cheap and easy to make. You can skip brewing broth and save your  ramen seasoning packets for future recipes.

To make them, you only need ramen and rice paper. You simply soften the paper and noodles, then wrap the ramen spring-roll-style in a log or square shape. If chewiness entices your chompers, you can enjoy it as is, but if you prefer more bite for your bucks, fry them in a pan with oil. Trust us, a crispy and moist consistency combined with a delicious dipping size will have you making rice paper-wrapped ramen all the time. 

Swap traditional pork with rice paper bacon

If dictionaries used images rather than words to define things, the term "flavorful" would be perfectly described with a picture of bacon. It's simple, bacon tastes delicious. From the smoky aroma to its delectable curling, most meats only dream of being as beloved. Each morning it serves as a centerpiece atop breakfast tables across America — at least for meat eaters. 

People transitioning to a plant-based diet lament missing out on the bacon experience, as most meatless alternatives fall short of the original. Just because you're anti-pork doesn't mean you have to be anti-delicious. With its neutral taste and malleable consistency, rice paper is the ingredient to make vegan bacon that's actually crispy . To get started, simply soften the rice paper, slice it into strips, and add flavor by marinating the strips. This can be done by using liquid smoke, the key to vegan-approved bacon flavor . You can also experiment with ingredients like soy or tamarind sauce, maple syrup, paprika, garlic, onion powder, or pepper. After infusing, bake the strips in the oven until they are nice and crisp. 

Turn rice paper into crunchy chips

One of the easiest ways to use rice paper is to turn it into crunchy chips. With a little time and hot oil, you can quickly cure your snacking pangs, and it's so easy you'll wonder why you didn't try it sooner. Using a wok, heat some oil and carefully dip a single sheet of rice paper in it, which instantly transforms it into a puffy and crispy chip. 

Although this process is easy peasy, there are some things to keep in mind. First, the oil needs to be on high heat similarly to when you fry foods, and second, you should use a tong to hold and dip the rice paper in and out of the oil rather than allowing it to rest, because the paper puffs immediately. After it resembles a wrinkly crispy treat, set it on paper towels to soak up the remaining oil, sprinkle on any seasoning you like, and dig in. You can also dip rice paper chips, top them with ceviche , or load them with other diced ingredients.

Substitute ramen noodles with rice paper

Since we're on the topic of creative ways to use rice paper, here is a clever ramen hack that will subvert all expectations. With a few easy steps and flicks of the wrist, rice paper can be used as a crave-worthy substitute for ramen noodles.

As with just about any recipe for rice paper, you'll need to first soften the edible sheets. After they become pliant, place the sheets on a cutting board and massage out any noticeable air bubbles. You then slice each sheet of rice paper into thin and stretchy strips, and soak them in cold water to prevent them from becoming sticky. Lastly, add the flavoring ingredients of your liking and toss it in a pan to cook, before using them in the ramen recipe of your choice. In no time, you'll be scarfing, slurping, and savoring a bowlful of rice paper ramen. 

Take a savory excursion with rice paper bourekas

From samosas and pierogies to empanadas and Cornish pasties, stuffed dough is enjoyed worldwide. Another doughy filled delight are  bourekas, the savory Israeli pastry . It's a treat that's traditionally filled with ground beef, cheese, or vegetables like spinach, eggplant, or potatoes. Popular far beyond Israel, bourekas can be eaten for a midday snack, served during celebrations, and even enjoyed for breakfast.

While homemade pastry or store-bought phyllo are the usual go-to dough materials for making bourekas, why not trade these heavier materials for a healthier option? With rice paper, you can have the taste of the original bourekas within a lighter shell. To make them, the rice paper must be soaked in warm water for a few seconds until bendable, but not softened as much as for making spring rolls. If it's too soft, you won't achieve the ideal crunch as it bakes. Then stuff them with your favorite filling, and bake them until golden brown. 

Get your sweet fix with rice paper boba tea

Boba tea fans get bubbly when you bring up their most beloved milky beverage. Originally created in Taiwan, boba has only been around since the 1980s, but has since become a worldwide phenomenon. Boba, also known as bubble tea, is a sweet milky concoction loaded with miniature balls of black tapioca pearls along with brown sugar and black tea, though other types of tea work with boba as well. If "cute and bubbly" was a beverage, boba would be it.

A super clever boba hack that involves rice paper allows anyone to make homemade gluten-free bubble tea in no time at all. After wetting the sheets, roll each under your palm into thin tubular strips. Then cut the sheets into small rice paper bubbles, and cook them in a pan with brown sugar and water until they turn brown. It's that easy!

Put a healthy spin on cannelloni with rice paper

Traveling throughout the hills of Italy, you'll come across countless styles of pasta. Cannelloni, similar to American manicotti, is a stuffed pasta dish that's awesome for its variety of crave-worthy ingredients. From marinara and meatballs to mozzarella and pesto, it is a culinary canvas open to numerous pasta-bilities. Versatility aside, you can put a healthy spin on this Italian classic with rice paper.

First, decide what your filling will be. Soften your rice paper sheets with warm water and place them on a paper towel to dry. Make sure not to over-soften them, as they should still retain some firmness. Once dry and pliable, drop a dollop of your ingredients in the center, roll it up like an egg roll, and place each cannelloni in a baking pan. After you finish forming your cannelloni, top with cheese and sauce and put it in the oven to bake for 15 minutes. 

Get your Korean BBQ fix with bulgogi rice paper rolls

Quintessentially Korean, bulgogi is a style of barbecued beef delicious enough to compete with some of America's top BBQ classics. Its flame-grilled cooking method is reflected in its name, derived from how to say "fire meat" in Korean. Bulgogi is typically made using cuts of steak like ribeye, tenderloin, or sirloin, and served with rice, lettuce, and other flavorful sides — and it can even be made for vegetarians and vegans with bulgogi-style shredded tofu . Beyond its undeniable taste, the best part about enjoying bulgogi is the communal dining experience. Tables at many Korean BBQ restaurants feature built-in grills that allow guests to enjoy bulgogi together.

While nothing can replace the original, it's never a bad idea to put a different spin on traditional recipes. You can ditch the chopsticks without losing the communal feel by preparing rice paper bulgogi. Simply wrap your bulgogi meat in rice paper similarly to spring rolls, and serve them at your next gathering as tasty finger food.

Satisfy your sweet tooth with dessert spring rolls

Rice paper may be associated with savory dishes, but their versatility includes sweets as well. Enjoy a dessert spring roll filled with banana, chocolate, and coconut. Moist and decadent, it checks every box on the "perfect dessert" list of requirements. The best part is that it can be enjoyed delectably warm or at room temp. And if you're not cuckoo for coconut, there are countless other ways to make dessert spring rolls.

Rather than using sugary confections, try filling the rice paper rolls with a refreshing fruit combo. Sliced peaches, strawberries, and kiwi with a touch of mint leaves will have friends raving about your summer get-togethers. If you want to make your spring rolls fancy, try making oven-baked apple spring rolls. All you have to do is flex your creativity, listen to your gut, and let the good times roll — pun intended.

Wrap your samosas with rice paper instead of dough

Samosas are one of the most recognizable stuffed-and-fried pastry types in the world. As a staple of Indian cuisine, their aromatic and savory charm has enchanted many curious foodies. Whether you know the difference between a masala and biryani, or only recently experienced curry for the first time, samosas are the perfect gateway food to a world of potential new favorites. For a healthier twist on this tasty treat, use rice paper in place of dough. It's like fusing Asian cuisines to create a samosa-stuffed spring roll.

Portable, crispy, and filling, you'll be licking flavorful remnants from your fingers. Rice paper wrappers are vegan-friendly and gluten-free, and can save you time in the kitchen. While handling the everyday hustle and bustle, it's never fun to rush recipes. Serve this clever twist at your next get-together or as a midday snack for the family. 

Make vegan-friendly rice paper pork rinds

If rice paper chips get your munchies going, wait until you bite into rice paper pork rinds. Vegan-friendly pork rinds, you say? Yes, as wild as that sounds, it's just further proof of rice paper's versatility. If you think about it though, the concept isn't that far-fetched. When flash-fried, rice paper develops the same crispy consistency as pork rinds, so all you need to add is a bit of flavor. Making them only takes a total of a few minutes, too!

Once rice paper hits the hot oil, it'll puff up in mere seconds. It's an easy snack that can feed large gatherings and will likely spark curious conversation as well. To recreate the classic pork rind taste, season it with smoked paprika, salt, and cayenne pepper. Beyond plain chips and pork rinds, you can also sprinkle them with cheesy powder for homemade cheese puffs.

Embark on a culinary voyage with rice paper boats

Some foods were made especially for loading with tasty toppings, and rice paper is a perfect carrier of flavor. When fried into large chips, rice paper can be used as "boats" for countless ingredient combinations. You can ride the wave to Flavorville, and fortunately, sea legs are not required. Try topping rice paper boats with minced meat soaked in sweet-and-salty hoisin sauce . It's a delicious recipe that works with the ground protein of your choice, and it can also be made vegan with a plant-based option.

For poultry lovers, try pairing rice paper boats with your favorite style of saucy barbecued chicken. Trust us, your tongue will thank you after it experiences the first juicy and crunchy bite. For those looking to reduce their meat intake, try loading your rice paper boat with a fresh and spicy coleslaw mixture. For the final flavorful touch, get your fiery fix with a drizzle of sriracha. 

Elevate dessert with rice paper mochi

The list of creative ways to use rice paper in cooking is not only extensive, it's unpredictably interesting. This next recommendation is a dessert that's sure to put a smile on your sweet tooth. Did you know that rice paper could be transformed into mochi? For those not hip to this special Japanese dessert, mochi is a type of sweet delight that's made with rice flour, powdered sugar, cornstarch, and water.

While there are two varieties of this Asian treat — mochi and mochi ice cream — the former kind filled with chewy rice-flour dough can be made using rice paper as an outer layer. Rather than initially kneading dough into flat circles to hold the filling, just load your filling onto a softened rice paper sheet, add any extra ingredients, set it in the fridge for 30 minutes, and dive in.

Get on a roll with rice paper sushi

The most obvious way to creatively use rice paper is to make sushi rolls. Bite-sized, nutritious, and scrumptious, sushi is adored worldwide for a reason. Rice paper serves a similar purpose as nori sheets, also known as seaweed paper. Both are thin, come in a pack, and are typically used to wrap ingredients. The main difference is that rice paper is neutral-flavored, which makes it adaptable to a wider variety of recipes. Depending on the brand and flavor you choose, nori sheets can also cost more.

If you've rolled sushi before, making the switch to rice paper should be fairly easy. Choosing your ingredients will probably take some time, but after you've decided, follow the general rice paper softening steps to make rolling up your sushi nice and neat. For a touch of tradition, add a small piece of seaweed paper to the roll along with the other ingredients. 

Rice Paper: From Traditional Wraps to Contemporary Culinary Canvas

Fact Checked By: Macaria Valerie

Post Updated On: June 8, 2024

As an Amazon Associate I earn from qualifying purchases.

At the intersection of tradition and innovation, one finds rice paper—a culinary staple with deep roots in Asian history, now making waves in contemporary global cuisine. Translucent, delicate, and versatile, rice paper serves as both a testament to ancient culinary practices and a canvas for modern culinary artistry. This ingredient, primarily composed of rice flour, has transformed dishes from the simple spring rolls of Vietnamese street food stalls to the avant-garde creations in fine dining establishments across the world. Dive into the world of rice paper and explore its origins, production, varieties, and its pivotal role in bridging the gap between traditional and contemporary gastronomy.

Table of Contents

Origins and historical significance of rice paper.

Rice paper , despite its name, isn’t made from the common grains of rice we associate with our meals. Instead, its primary ingredient is often the pith of a small tree, Tetrapanax papyrifer, commonly known as the rice-paper plant, native to the swampy forests of Taiwan and regions of mainland China. This unique paper has played a multifaceted role in Asian culture, art, and cuisine, making its origins and history both fascinating and integral to understanding its global appeal.

Traditional Roots

The origin of rice paper dates back to ancient China, with some records suggesting its use during the Tang dynasty (618–907 AD) and perhaps earlier. Initially, it was developed as a medium for writing and painting due to its smooth texture, which was perfect for Chinese calligraphy and delicate brushwork.

Significance in Art and Literature

The beauty of rice paper lies in its absorbent nature, making it an ideal substrate for ink and watercolor paintings. Traditional Chinese and Japanese paintings often utilized rice paper to capture intricate details of nature, landscapes, and portraits. This paper allowed for a blending of colors and a diffused, soft appearance, making artworks look ethereal and luminous. Additionally, rice paper scrolls became an essential medium for preserving literature, historical records, and religious texts.

Evolution into Culinary Uses

While the term “rice paper” in the art world referred to the aforementioned product made from the pith of the Tetrapanax papyrifer tree, in the culinary realm, it evolved to describe a different product altogether. The edible rice paper, originating in Vietnam and other parts of Southeast Asia, was made from rice flour, water, and salt, pressed into thin sheets and sun-dried. These translucent sheets became a staple in various Asian cuisines, utilized for making spring rolls and other delicacies.

Symbolism and Cultural Significance

In some Asian cultures, rice paper embodies purity, resilience, and versatility. Its purity is represented by its translucent, delicate nature; resilience is showcased by its ability to hold together a myriad of ingredients without tearing, and its versatility is evident in its widespread use, from art to cuisine.

Spread to Western Cultures

With the advent of global trade and the migration of Asian communities to the West, rice paper found its way to European shores by the 19th century. Western artists, intrigued by its unique texture and properties, began to incorporate it into their art techniques. Meanwhile, the culinary type of rice paper started appearing in global fusion dishes, reflecting the melding of Eastern and Western culinary traditions.

The journey of rice paper, from ancient scrolls to delicious spring rolls, is a testament to human innovation and the ability of a simple product to transcend its traditional boundaries. As both a canvas for artistic expression and a vessel for culinary delights, rice paper’s historical significance is interwoven with the cultural tapestry of Asia and, eventually, the world.

Composition and Production of Rice Paper

The journey from raw materials to the delicate sheets of rice paper we recognize is a blend of tradition, art, and science. While there are different types of rice paper, depending on their intended use, we’ll delve into both the artistic and culinary versions, exploring their distinct compositions and production methods.

1. Artistic Rice Paper

Composition:.

• Pith : The primary ingredient is the pith from the Tetrapanax papyrifer tree, also known as the rice-paper plant.
• Water : Used to soften and process the pith.

Production:

• Harvesting : The rice-paper plant, which grows predominantly in Taiwan and parts of China, is harvested for its thin inner stem or pith.
• Pith Processing : The outer bark is stripped away, leaving the soft inner pith. This pith is then soaked in water to soften.
• Rolling : Once softened, the pith is rolled out into thin, round discs.
• Drying : The sheets are then left to dry naturally, resulting in the final rice paper, ready for artistic endeavors.

2. Culinary Rice Paper

• Rice Flour : The main component that provides the primary texture and taste.
• Water : Helps in binding the rice flour and achieving the desired consistency.
• Salt : Added for flavor and as a preservative to enhance shelf life.
• Tapioca Flour (in some variations): This gives the rice paper its characteristic chewiness.
• Mixing : The rice flour, water, and salt (and tapioca flour, if used) are mixed together to create a smooth batter.
• Steaming : The batter is then poured onto a cloth tightly stretched over a pot of boiling water. It’s spread thinly and evenly, then covered and steamed briefly until the sheet is cooked.
• Transferring : The thin, delicate sheet of rice paper is carefully lifted off the cloth and placed onto bamboo mats or racks.
• Sun-drying : These sheets are then dried under the sun. The warm and direct sunlight helps them dry quickly, preserving their texture and preventing spoilage.
• Storage : Once fully dried, the sheets are stacked and stored in a cool, dry place, ready for culinary use.

The production of rice paper, whether for artistic or culinary purposes, reflects a deep-rooted appreciation for natural materials and traditional methods. While the processes differ based on their intended application, both types of rice paper are a testament to the delicate balance between simplicity and sophistication. Their enduring popularity, both in their regions of origin and globally, highlights the timeless appeal of products that are crafted with care and respect for heritage.

Varieties and Uses of Rice Paper

Rice paper, though bearing a singular name, encompasses a range of types and uses across cultures. Its versatility has been demonstrated over time, with both its varieties serving different purposes in artistic, literary, and culinary domains. Let’s delve into the diverse types of rice paper and their respective applications.

• Xuan Paper ( 宣 纸): Originating from the Xuan city in China, this is one of the most famous types of rice paper used in traditional Chinese calligraphy and painting. It’s known for its fine texture, absorbency, and strength.
• Shoji Paper : Used in Japanese culture primarily for making room dividers or screens, this type of rice paper offers a certain level of opacity while still allowing light to pass through.
• Calligraphy : The absorbent nature of artistic rice paper makes it perfect for traditional ink brush writing.
• Painting : Its ability to hold watercolors and inks without bleeding is prized in Asian traditional painting.
• Crafts : Used in lanterns, decorative screens, and other traditional Asian crafts.
• Round Rice Paper: This is the most common shape, often used for Vietnamese spring rolls (Gỏi Cuốn) or salad rolls .
• Square Rice Paper : Typically utilized in some traditional dishes or regional variations of spring rolls.
• Triangle Rice Paper : Less common but can be found in specific regional dishes or for unique presentations.
• Spring Rolls : Perhaps the most popular use. Rice paper serves as the translucent wrapper holding together a mix of shrimp, herbs, pork, rice vermicelli, and other ingredients.
• Salads : Shredded or crumbled rice paper is often used in Vietnamese rice paper salads, mixed with a blend of seasonings, herbs, and proteins.
• Snacks : In some cultures, rice paper is deep-fried to create crispy chips or snacks.
• Desserts : Some innovative chefs use rice paper as a base for certain desserts, leveraging its neutral taste and crisp texture when toasted.

3. Specialized Rice Paper Varieties

Some rice papers are infused with additional ingredients to enhance flavor or appearance:

• Herb-Infused Rice Paper : Contains bits of herbs like basil or mint for added flavor and visual appeal.
• Brown Rice Paper : Made with brown rice flour, offering a slightly nuttier flavor and a more rustic appearance.
• Colored Rice Paper : Infused with natural colors from vegetables or herbs, used for festive occasions or unique culinary presentations.

The world of rice paper is vast and diverse, with each type bearing its own history, cultural significance, and application. From the delicate brush strokes of an artist to the culinary masterpieces of a chef, rice paper continues to be an integral medium of expression and enjoyment. Whether you’re appreciating it on a canvas or savoring it on your plate, rice paper stands as a testament to the adaptability and inventiveness of human traditions.

Differences between Eastern and Western Rice Papers

Rice paper is a term that has varied interpretations, and its meaning can shift based on cultural and regional contexts. Notably, while Eastern and Western cultures both utilize rice paper, their versions and applications differ substantially. Here’s a comparative look at rice paper from both traditions:

1. Origin & Primary Use

• Eastern Rice Paper : Originating in Asia, primarily in countries like China and Vietnam, this form of rice paper has deep historical roots. It is intrinsically linked with traditional artistic and culinary practices. The artistic variant was used for calligraphy and painting, while the culinary type was employed in food preparation, particularly for dishes like spring rolls.
• Western Rice Paper : In Western contexts, rice paper often refers to a type of confectionery paper. This edible paper is used primarily for decorative purposes in baking, like cake decorations, or as a wrapper for candies.

2. Composition

• Eastern Rice Paper (Artistic): Made from the pith of the rice-paper plant (Tetrapanax papyrifer), it’s not actually derived from the rice grain. This paper is thin, delicate, and highly absorbent.
• Eastern Rice Paper (Culinary): Made from rice flour, water, and sometimes tapioca or other ingredients. It is thin, translucent, and edible.
• Western Rice Paper : Made from rice starch, and sometimes potato starch. It’s edible and often has a slightly sweet taste due to the addition of flavorings or sugar.

3. Texture & Appearance

• Eastern Rice Paper (Artistic): Smooth, absorbent, and can be slightly translucent to opaque.
• Eastern Rice Paper (Culinary): Translucent when moistened, flexible, and becomes more transparent as it’s filled and rolled.
• Western Rice Paper : Generally thin, opaque, and has a firm yet dissolvable texture in the mouth.

4. Applications

• Eastern Rice Paper (Artistic): Used for traditional calligraphy, ink paintings, and crafts like lantern-making.
• Eastern Rice Paper (Culinary): Employed in dishes like spring rolls, rice paper salads, and sometimes even fried as a snack.
• Western Rice Paper : Used for cake decorations, candy wrappers, and other confectionery purposes. It can be printed on, allowing for personalized designs in baking.

5. Cultural Significance

• Eastern Rice Paper : Deeply rooted in history and tradition, it carries both aesthetic value in arts and symbolic meaning in culinary presentations. For instance, in dishes, the transparency of the rice paper can symbolize purity or freshness.
• Western Rice Paper : Its significance is more modern and often linked to confectionery arts. It offers a way to add decorative elements to baked goods without altering the flavor profile significantly.

While the term “rice paper” bridges Eastern and Western traditions, its interpretation, use, and significance vary dramatically between the two. These differences underscore the rich tapestry of global cultures and the unique ways in which simple materials can be transformed based on regional influences and historical contexts.

Nutritional Profile of Rice Paper

Rice paper, particularly the edible culinary type used in various dishes, is derived mainly from rice flour, which gives it a unique nutritional profile. Here’s an overview of the nutritional content of rice paper:

Macronutrients:

• Carbohydrates : As rice paper is primarily made from rice flour, it’s predominantly a source of carbohydrates. These carbs provide energy , making them a primary macronutrient in many Asian diets.
• Protein : Rice paper contains a minimal amount of protein. It’s not a significant source of this macronutrient.
• Fats : Rice paper is very low in fats. However, the fat content can change depending on how the rice paper is used in cooking. For instance, if it’s fried, the fat content will increase.

Vitamins & Minerals:

• Iron : Rice, and by extension rice paper, can contain small amounts of iron, though it is not a primary source.
• Calcium: Some rice papers, especially those that might include tapioca in their composition, can offer a small amount of calcium.
• Potassium: Rice contains potassium, so rice paper might provide a minimal amount.
• Sodium: While rice itself is low in sodium, rice paper often contains added salt, which increases its sodium content.

Dietary Fiber:

• Rice paper is low in dietary fiber since it’s made from refined rice flour. However, the fiber content can vary slightly based on the specific type of rice or other flours used.

Other Considerations:

• Calories: Rice paper is relatively low in calories, especially when used as a wrapper for fresh spring rolls. However, its caloric content can increase significantly if it’s fried or used in more calorie-dense dishes.
• Gluten-Free: Since rice paper is made from rice flour (and sometimes tapioca), it’s naturally gluten-free. This makes it a suitable choice for those with celiac disease or gluten sensitivities.
• Glycemic Index (GI): Given its primary ingredient, rice paper can have a moderate to high GI, meaning it can raise blood sugar levels. However, when combined with protein and fiber-rich fillings, the overall GI of the dish may balance out.

While rice paper is not particularly nutrient-dense, it’s a versatile culinary tool that fits well into a balanced diet, especially when filled with a variety of fresh, wholesome ingredients. Its low calorie and gluten-free nature can make it an attractive option for those watching their caloric intake or avoiding gluten. However, like with any food, it’s essential to consider the overall context of its consumption and pair it with nutrient-rich fillings or accompaniments.

Health Benefits and Concerns of Rice Paper

Like many foods, rice paper has both health benefits and potential concerns. Understanding these can help consumers make informed decisions about including rice paper in their diet. Here’s a breakdown:

Health Benefits:

• Low in Calories : One sheet of rice paper is relatively low in calories, making it a lighter alternative to some other types of wraps or bread.
• Gluten-Free : People with celiac disease or gluten sensitivities can safely consume rice paper, as it’s naturally free from gluten.
• Versatility : The neutral taste and adaptable nature of rice paper allow it to be paired with a wide variety of ingredients. This can lead to nutrient-dense meals when combined with vegetables, lean proteins, and other healthful fillings.
• Low in Saturated Fat : On its own, rice paper contains negligible amounts of saturated fats. Consuming foods low in saturated fats can be beneficial for heart health.
• Digestibility : Rice paper, made primarily from rice flour, is typically easy on the digestive system, making it suitable for many individuals.

Health Concerns:

• Glycemic Index : Rice paper can have a moderate to high glycemic index, which can cause a rapid rise in blood sugar levels. This may be a concern for individuals with diabetes or those watching their blood sugar levels.
• Low in Fiber : Made from refined rice flour, rice paper doesn’t contribute significantly to daily fiber intake. Dietary fiber is essential for digestive health and can help regulate blood sugar and cholesterol levels.
• Sodium Content : Some rice papers contain added salt, which can increase their sodium content. High sodium intake is associated with increased risks of high blood pressure and cardiovascular diseases.
• Risk When Fried : While rice paper is often used for fresh dishes, it can also be deep-fried. When used this way, it absorbs oil, increasing its calorie and fat content, potentially making it less heart-healthy.
• Limited Nutrient Profile : On its own, rice paper doesn’t provide a significant amount of vitamins or minerals. It’s essential to pair it with nutrient-dense foods to ensure a balanced meal.

Rice paper offers certain health benefits, especially for those seeking gluten-free alternatives. However, like many foods, its health implications depend on the broader context of its use. When consumed as part of a balanced diet and paired with a variety of fresh and wholesome ingredients, rice paper can be part of healthy, nutritious meals. On the flip side, when fried or paired with less healthy fillings, its benefits can be overshadowed by the overall dish’s nutritional profile. As always, moderation and context are key.

Culinary Techniques with Rice Paper

Rice paper is a versatile ingredient in the culinary world, especially within Asian cuisines. Its unique texture and neutral flavor profile make it suitable for various dishes. Here’s an exploration of the most common culinary techniques involving rice paper:

Soaking: Before using rice paper in most dishes, it typically needs to be rehydrated, as it’s often sold in a dry, brittle state.

• Technique: Dip each rice paper sheet in warm water for a few seconds until it softens. Lay it on a flat surface, and it’ll continue to soften as you add fillings.

Rolling: The pliable nature of soaked rice paper makes it ideal for wrapping ingredients.

• Technique: Place desired fillings in the center or slightly towards one end of the softened rice paper. Fold in the sides and then roll, much like a burrito. This is the standard technique for making Vietnamese spring rolls (Gỏi Cuốn) and similar dishes.

Frying : Rice paper can be deep-fried to create crispy snacks or appetizers.

• Technique : After filling the rice paper, seal it and deep fry in hot oil until golden and crispy. This method is commonly used for dishes like fried Vietnamese spring rolls (Chả Giò).

Grilling: Stuffed rice paper rolls can also be grilled for a smoky flavor and crispy texture.

• Technique : After filling and sealing, brush the rolls with a bit of oil and grill them until charred and crispy.

Steaming : In some culinary applications, rice paper rolls are steamed to create a soft and chewy texture.

• Technique : Place filled rice paper rolls in a steamer and steam for a set amount of time until cooked through. This technique is less common but can be found in some traditional dishes.

Layering : In certain dishes, multiple sheets of rice paper are layered to achieve a specific texture or effect.

• Technique : Layer soaked rice paper sheets with fillings in between, then cut or shape as desired. This can be done for specific desserts or regional dishes.

Toasting : For a quick snack, rice paper can be toasted over open flame or in a pan.

• Technique : Hold the dry rice paper over an open flame or place it in a hot pan. Rotate until it’s crispy and slightly puffed. This toasted rice paper can be eaten as a snack or crushed into dishes for added texture.

Rice paper’s versatility is truly showcased by the variety of culinary techniques it can undergo. Whether you’re aiming for a fresh and light snack or a hearty, crispy roll, rice paper can adapt to the dish’s needs. Experimenting with these techniques can lead to a range of delicious outcomes, allowing home cooks and chefs alike to explore the breadth of Asian culinary traditions and beyond.

Popular Dishes Featuring Rice Paper

Rice paper is a staple in many Asian cuisines, playing a starring role in several traditional and contemporary dishes. Here are some popular dishes that showcase the versatility of rice paper:

Gỏi Cuốn (Vietnamese Fresh Spring Rolls):

Description: These are cold, fresh rolls made with rice paper filled with ingredients like shrimp, herbs, pork, rice vermicelli, and other ingredients. They are typically served with a dipping sauce, often made from hoisin sauce, peanuts, and chili.

Chả Giò or Nem Rán (Vietnamese Fried Spring Rolls):

Description: Rice paper wrappers filled with a mixture of ground pork, shrimp, mushrooms, and noodles, then deep-fried to a golden brown. They’re usually served with nuoc cham, a tangy Vietnamese dipping sauce.

Bánh Tráng Nướng (Vietnamese Rice Paper Grilled “Pizza”):

Description : This popular street food involves grilling a piece of rice paper until crispy and topping it with ingredients like egg, scallions, dried shrimp, and chili sauce. It’s sometimes referred to as “Vietnamese pizza” because of its round shape and variety of toppings.

Bánh Tráng Trộn (Rice Paper Salad):

Description : A vibrant salad made by cutting rice paper into thin strips and mixing them with fresh herbs, quail eggs, dried shrimp, and a tangy, spicy dressing.

Bánh Xèo (Vietnamese Crispy Pancakes):

Description : Though not made of rice paper per se, the batter for this dish often includes rice flour, giving it a similar consistency. Bánh Xèo are thin, crispy pancakes filled with ingredients like shrimp, pork, and bean sprouts. Pieces of the pancake are often wrapped in rice paper with herbs before being dipped in sauce and eaten.

Bánh Hỏi (Fine Rice Vermicelli Sheets):

Description : These are thin sheets of woven rice noodles, often served with grilled meat. They are sometimes mistaken for rice paper due to their appearance.

Banh Trang Kep (Rice Paper Sandwich):

Description : Two rice paper sheets are toasted until crispy and then filled with a mixture of minced meat, quail eggs, and seasonings, creating a sandwich-like snack.

Salim (Thai Rice Noodle Dessert):

Description: While not exactly rice paper, the chewy, colorful noodles in this sweet Thai dessert are reminiscent of rice paper’s texture. The noodles are made from mung bean or rice flour and served in sweetened coconut milk.

Rice paper’s adaptability and neutral flavor make it an excellent foundation for a plethora of dishes, ranging from savory appetizers to sweet desserts. These dishes provide a glimpse into the rich culinary tapestry of Asian cuisines, where rice paper has been celebrated for centuries. Whether you’re enjoying a fresh spring roll on a warm day or a crispy grilled “pizza” off the streets of Ho Chi Minh City, rice paper promises a delightful culinary experience.

Storing and Preservation of Rice Paper

Proper storage and preservation of rice paper are crucial to maintain its quality and extend its shelf life. Whether you’re dealing with uncooked, dry rice paper sheets or prepared dishes using rice paper, here are some guidelines to ensure optimal storage:

Uncooked Dry Rice Paper Sheets:

• Cool, Dry Place : Store unopened packages of rice paper in a cool, dry place away from direct sunlight. A pantry or kitchen cabinet is ideal.
• Airtight Containers : Once the package is opened, transfer any unused rice paper sheets to an airtight container or resealable plastic bag. This prevents moisture absorption, which can make the sheets sticky and unusable.
• Shelf Life: While rice paper can last a long time when stored properly, it’s best to use it within a year of purchase to ensure optimal quality.

Cooked or Prepared Rice Paper Dishes:

• Refrigeration : If you’ve made dishes using rice paper, like fresh spring rolls, store them in the refrigerator if they aren’t consumed immediately. Place them in an airtight container, separating layers with parchment paper to prevent sticking.
• Short Storage Time : Prepared dishes using rice paper, especially those containing perishable fillings, should be consumed within 1-2 days for optimal freshness.
• Freezing : Some dishes with rice paper, like fried spring rolls, can be frozen before frying. Lay them on a tray in a single layer to freeze, then transfer to airtight containers or freezer bags. Fry them directly from the freezer without thawing. Note that not all rice paper dishes are suitable for freezing, especially those with high moisture content.
• Avoid Microwaving : Reheating rice paper dishes in the microwave can make them soggy. It’s better to use an oven or toaster oven to reheat and retain crispiness, especially for fried items.

Tips for Prolonged Storage:

• Use Silica Gel : If you live in a particularly humid area, consider placing a packet of food-grade silica gel in the container where you store dry rice paper sheets. This will help absorb any excess moisture.
• Check for Signs of Spoilage : Before using stored rice paper, check for any signs of mold, off-odors, or other indications of spoilage.
• Label and Date : If you’re freezing prepared dishes or storing opened rice paper, it’s helpful to label and date the container. This way, you can easily keep track of how long items have been stored and use them within the recommended time frame.

Proper storage and preservation of rice paper, both in its uncooked form and in prepared dishes, are essential to maintain quality and safety. By following the recommended guidelines and tips, you can enjoy rice paper in its best form, whether you’re savoring it immediately after preparation or at a later time.

Rice Paper in Modern Gastronomy

The gastronomic world has always been in flux, adapting and evolving with time, trends, and technological innovations. In this panorama of continual evolution, traditional ingredients like rice paper find renewed significance and innovative applications. Modern gastronomy, with its emphasis on creativity, aesthetics, and experiential dining, has embraced rice paper as more than just an ingredient for traditional Asian dishes. Here’s a look at the role of rice paper in contemporary culinary arts:

• Deconstructed Dishes : Modern chefs often reimagine classic dishes by deconstructing and then reconstructing them with a twist. Rice paper has been used in such dishes to provide texture contrast or as a unique presentation medium. For instance, a traditional spring roll might be reimagined with fillings presented atop a crispy rice paper disc.
• Edible Art : With its translucent quality when moistened, rice paper offers chefs a canvas to create edible works of art. Intricate patterns, images, or even printed edible inks can be displayed on rice paper for aesthetically pleasing dishes.
• Texture Play: Modern gastronomy often emphasizes a play on textures. Rice paper can be served in various states—crispy, soft, chewy, or somewhere in between—to introduce different textural elements to a dish.
• Molecular Gastronomy : In the realm of molecular gastronomy, chefs have experimented with rice paper to encapsulate liquids or to create unique shapes and forms, thanks to its adaptable nature.
• Health-Conscious Adaptations : As the culinary world becomes increasingly health-conscious, rice paper offers a gluten-free, low-calorie alternative to traditional wraps or bases in various dishes.
• Infused Flavors : Rice paper’s neutral flavor profile makes it a suitable candidate for infusion with different flavors. Chefs might soak rice paper in broths or infusions to introduce new taste dimensions to a dish.
• Interactive Dining : Some modern dining establishments focus on an interactive experience, allowing diners to be a part of the food preparation process. Rice paper can be provided for diners to make their own rolls, choosing from an array of ingredients, much like a gourmet DIY experience.
• Pairing with Non-Traditional Ingredients : Moving away from traditional pairings, chefs are incorporating rice paper with ingredients from various cuisines. Think rice paper rolls with Mediterranean fillings or a fusion of Asian and South American flavors.

Rice paper, with its rich history and versatile nature, has seamlessly integrated into the fabric of modern gastronomy. Its potential applications are vast and varied, limited only by a chef’s creativity. As global culinary boundaries blur and fusion becomes more prevalent, it’s exciting to envision the future possibilities for rice paper in the gastronomic world.

Frequently Asked Questions (FAQ)

Q: what is rice paper.

A: Rice paper is a thin, translucent sheet made primarily from rice flour, though some versions also include other ingredients like tapioca or other starches. It’s commonly used in various Asian cuisines, especially Vietnamese, for dishes like spring rolls.

Q: How is rice paper different from spring roll wrappers or wonton wrappers?

A: Rice paper is typically translucent, thin, and becomes pliable when moistened. In contrast, spring roll wrappers (used for fried spring rolls) and wonton wrappers are often made of wheat and are thicker, requiring cooking to become edible.

Q: How do you soften rice paper?

A: Rice paper is softened by dipping it briefly in warm water until it becomes pliable. After removing from the water, it’s laid flat on a work surface and will continue to soften as it absorbs the water.

Q: Can rice paper be eaten raw?

A: Rice paper becomes edible and digestible once it’s moistened. While it’s typically used as a wrapper and then filled, it doesn’t require additional cooking after being moistened, making it “raw” edible.

Q: How long does rice paper last in storage?

A: Unopened rice paper can last for months when stored in a cool, dry place. Once opened, it’s best to store in an airtight container to prevent it from becoming stale.

Q: Can I fry rice paper?

A: Yes, rice paper can be fried. When used as wrappers for spring rolls and deep-fried, they become crispy and golden.

Q: What can I do if my rice paper tears?

A: If the rice paper tears while you’re working with it, you can overlay a second moistened sheet over the first, reinforcing the tear and allowing you to continue.

Q: Is rice paper gluten-free?

A: Traditional rice paper made purely from rice flour is gluten-free. However, always check the label, especially if the rice paper includes other ingredients or is processed in facilities that handle gluten.

Q: Can I substitute rice paper in recipes?

A: Rice paper has a unique texture and properties, but in some recipes, it might be substituted with alternatives like lettuce leaves (for fresh wraps) or wheat-based wrappers for fried dishes, though the taste and texture will differ.

Q: How do you store dishes made with rice paper?

A: Dishes like fresh spring rolls should be consumed quickly for the best texture, but if needed, they can be stored in the refrigerator for a short time. Separate them with parchment or wax paper to prevent sticking.

Q: How is the texture and flavor profile of rice paper affected by the proportion of rice flour to other starches, such as tapioca?

A: The inclusion of tapioca or other starches can alter the texture of rice paper, making it slightly chewier than those made purely from rice flour. Tapioca can also give the paper a slightly glossier appearance. In terms of flavor, pure rice paper has a more distinct rice flavor, while those with tapioca or other starches might be more neutral.

Q: What impact does water temperature have when softening rice paper?

A: The temperature of the water can significantly affect the softening process. Warm water makes the rice paper pliable more quickly and evenly. If the water is too hot, the paper might soften too rapidly, leading to tears. Conversely, cold water will require a longer soaking time and might not soften the paper uniformly.

Q: Are there variations in rice paper production methods across different Asian regions?

A: Yes, different regions might have slight variations in production methods, influenced by local rice varieties, climate, and traditional practices. For instance, the thickness, texture, and translucency of Vietnamese rice paper might differ from Thai or Chinese versions.

Q: How does the aging of rice flour affect the quality of the final rice paper product?

A: Aged rice flour, typically from rice aged for about a year, can result in a more uniform and smoother texture in the rice paper. Freshly milled rice flour might produce rice paper that’s slightly grainier.

Q: What culinary techniques can enhance the inherent flavors of rice paper in dishes?

A: While rice paper has a relatively neutral flavor, toasting or grilling it briefly can introduce a subtle nutty taste. Additionally, infusing the water used for softening with herbs or broths can impart additional flavors to the rice paper.

Q: How does humidity affect the storage and usage of rice paper?

A: Humidity can be detrimental to stored rice paper, making it damp, sticky, and challenging to handle. In humid environments, it’s crucial to store rice paper in airtight containers, possibly with food-grade desiccants, to maintain its dryness and quality.

Q: Are there any modern innovations in rice paper production to cater to the global market?

A: With the global demand for gluten-free and health-conscious products, there are innovations in rice paper production to enhance nutritional profiles, such as the addition of fortified ingredients or the use of organic rice. Additionally, flavored or colored rice papers are emerging to cater to diverse culinary applications.

Q: How do different rice varieties influence the characteristics of rice paper?

A: Different rice varieties can influence the texture, color, and translucency of rice paper. For instance, rice paper made from glutinous or sticky rice might be chewier than that made from long-grain rice.

Q: Are there any specific culinary pairings that can either complement or contrast with the texture and flavor of rice paper?

A: Given its neutral profile, rice paper is versatile. Crispy vegetables, herbs, and textured proteins complement its soft texture. In terms of flavor, savory sauces, tangy vinaigrettes, or spicy dips can offer a contrast to its mild taste.

Q: What considerations should chefs make when incorporating rice paper into fusion or non-traditional dishes?

A: Chefs should consider the moisture content of fillings, as overly wet ingredients can make rice paper soggy. Additionally, understanding the delicate nature of rice paper is crucial to avoid overfilling or rough handling, which can lead to tears.

These answers delve deeper into the nuances of rice paper, providing insights that might be particularly valuable to culinary professionals or enthusiasts looking for a comprehensive understanding of this ingredient.

From the bustling markets of Hanoi to the sophisticated kitchens of Paris, rice paper has showcased its unparalleled adaptability and enduring appeal. It is a culinary element that, while deeply rooted in age-old traditions, continues to inspire and challenge modern chefs in their gastronomic endeavors. The duality of rice paper—its historical significance juxtaposed with its modern applications—underscores the ingredient’s timelessness. As we’ve journeyed through its intricate history, myriad uses, and transformative role in contemporary cuisine, one thing remains clear: rice paper, in its delicate simplicity, transcends borders and eras. It stands as a testament to the beauty of culinary evolution, reminding us that even the most humble ingredients can leave an indelible mark on the world of gastronomy.

Rice Paddy Art: Where Agriculture Meets Aesthetics

Aromatic Journey Through the Gulf: Mastering the Traditional Machboos Recipe

Macaria Valerie

About the author, related posts:, rice cookers reviews: why trusting the wrong source can lead to a bad purchase.

As an Amazon Associate I earn from qualifying purchases. When it comes to purchasing a new rice cooker, many buyers…

Rice Cookers Review: What to Look for and Why It Matters Before You Buy

As an Amazon Associate I earn from qualifying purchases. When it comes to purchasing a rice cooker, many buyers are…

Avoid Buyer’s Regret: How a Rice Cooker Review Can Save You Time and Money

As an Amazon Associate I earn from qualifying purchases. Purchasing a rice cooker can seem like a simple task, but…

Top Features of the Cuckoo Rice Cooker: Why It’s a Must-Have for Every Kitchen

As an Amazon Associate I earn from qualifying purchases. In today’s fast-paced world, having kitchen appliances that simplify meal preparation…

Leave a Comment Cancel reply

Save my name, email, and website in this browser for the next time I comment.

For security, use of CloudFlare's Turnstile service is required which is subject to the CloudFlare Privacy Policy and Terms of Use .

I agree to these terms (required).

Expertreviewsbestricecooker.com is a participant in the Amazon Services LLC Associates Program, an affiliate advertising program designed to provide a means for sites to earn advertising fees by advertising and linking to Amazon.com. Additionally, expertreviewsbestricecooker.com participates in various other affiliate programs, and we sometimes get a commission through purchases made through our links.

Expert Reviews Best Rice Cooker

Expertreviewsbestricecooker.com is a blog about rice cooker, rice recipes and cooking activities and your go-to resources!

© 2024 expertreviewsbestricecooker.com, All Right Reserved. Design, Development and Maintenance by ERBRC.

about us | contact | terms of service | privacy policy | disclaimers | disclosure | cookies policy | code of ethics | complaints policy | editorial policy | legal disclaimer

What is Rice Paper? Is It Edible?

Table of Contents

Have you ever eaten dumplings that had a semi-transparent wrapper? Or maybe you’ve had spring rolls wrapped in the same semi-translucent paper? If you’ve ever wondered what that wrapper is, look no further as here’s your answer: rice paper. Read on to know more about this thin sheet that is not only used for food but also used in numerous products and applications.

What Is Rice Paper Made Of?

Rice paper is made from the pith of the Asian rice plant or a combination of several other plants, including mulberry and hemp. Traditionally, rice paper sheets are used in Asian arts and crafts.

As for edible paper, it is usually made from rice starch. Sometimes, other ingredients such as tapioca starch, milk, and bananas are also added to increase flavor and texture.

Types of Rice Paper

A lot of times when the term “rice paper” is used or mentioned, it can be difficult to find exactly the paper that you need. For a lot of people, the one that typically comes to mind is the food wrapping paper. In actuality, there are different types of rice paper that all have different uses.

Paper Made from the Rice Paper Plant

Around the 20th century, a type of paper made from the Tetrapanax Papyrifer plant was imported to Europe from Asia. This paper was commonly referred to as “rice paper” due to its Asian origins and bright white color. This paper is typically used to make artificial flowers, as a sole for shoes, or used for paintings. It is generally not used for writing.

Edible Rice Paper

In the food industry, edible rice paper is used to wrap food, resulting in dishes such as spring rolls, fresh summer rolls, rice paper dumplings, and the like. In Vietnam, these paper sheets are referred to as nem wrappers. Typically sold dried thin and in a round sheet form, edible paper can be made with rice starch but some incorporate other ingredients like tapioca flour and milk to add flavor. 

Before using edible rice sheets, they need to be rehydrated to make them soft and pliable. To do so, add cold or warm water to a shallow dish or bowl that is wider than the size of the paper. It’s recommended to work with one sheet at a time. Dip a whole sheet in the water for a few seconds, shake it gently to drain the excess water, or pat it dry with a paper towel, then place it onto a flat work surface. If it is too wet, leave and air dry for 1 to 2 minutes, or place it on a dry kitchen towel. 

You can also store rice papers for use later. To do so, place them in a resealable bag or airtight container and then put them away in a cool, dry place. Be sure that they’re far away from heat and direct sunlight.

Wrapping Rice

In Asia, there is paper made from the bark of the mulberry tree which is then used to wrap rice bundles for transportation. While this is actually industrial mulberry paper, a lot of communities refer to it as rice paper.

Rice Paper for Arts, Crafts, and Writing

Papers from Asian countries are often called the generic term rice paper. These papers can have multiple origins and can be made with various pulp and fiber ingredients. Mulberry trees are the most common source but other plants such as the lokta bush are also used.

Mulberry Paper

Thailand has perfected the mass production of mulberry paper. The process begins with carefully preparing mulberry bark strands which are then hand-made into different sizes and weights of paper. For example, unryu paper is soft and translucent while heavyweight mulberry papers provide stiffness and texture.

Shoji Paper

These papers are also used in architecture. Japanese shoji screens are made of semi-translucent mulberry paper that is often left naturally white or bleached. The shoji sheets are placed inside the frame and moistened. When dry, the paper shrinks. The sheets become smooth and taut when held firmly in the screen frame.

Washi Paper

This type of paper is a highly-refined mulberry paper. One branch of Japanese papermaking focuses on taking mulberry, mitsumata, and gampi papers and turning them into papers of such high quality that they are used in book and document conservation efforts. The resulting thin paper is virtually transparent, making them ideal in using to repair books. 

Aside from washi, another branch of Japanese papermaking, Yuzen, uses mulberry paper to display intricate and artistic designs.

Hanji Paper

In Korea, rice sheets are formally known as hanji paper and are traditionally used for legal and important documents that must last for a lifetime. Hanji paper achieves this durability by adding hibiscus meniot to the paper pulp. Moreover, the pulp mixture does not contain any acid, making it an ideal archival paper.

Rice sheets are called xuan paper in China. It was originally made from the bark of the Pteroceltis Tatarinowii tree. Over the years, other pulps such as mulberry, bamboo, and rice have made their way into Chinese paper products.

Lokta Paper

In Nepal, the lokta bush is more common than mulberry. The bark of the lokta shrub is used for making paper in the same way mulberry is used in Thailand, Japan, and Korea. Nepalese artisans have also gained attention for converting lokta sheets into useful products and ornaments such as bags and rosettes.

Is Rice Paper the Same as Spring Roll Wrappers?

Rice paper can also be used to make fried spring rolls. However, there are also spring roll wrappers being sold in the market that don’t use rice flour and instead use all-purpose flour or wheat flour. Compared to rice paper wrappers, spring roll wrappers made with flour are not as transparent. They are still thin and delicate like rice papers but other people may find them slightly thicker.

What Is Special About Rice Papers?

When it comes to arts and documentation, rice papers are rotproof and mothproof, allowing artwork and written work to retain their original freshness and details even if they are from a hundred years ago. Another feature is that they are not easy to crumple and fold, and therefore there is no harm done to the paper.

When it comes to edible rice sheets, they can get a bit sticky when dipped in water. This stickiness allows the sheets to hold all the ingredients well when they’re used for dishes such as dumplings and spring rolls. Rice sheets are also healthy as they contain a moderate amount of carbohydrates and proteins, allowing the body to perform efficiently.

Is Rice Paper Good or Bad for You?

White rice flour is low in fat and calories which can be good for individuals who want to keep a healthy weight. Moreover, rice sheets are commonly paired with ingredients such as fresh vegetables, lean meats, and other proteins, making them a great complement to most diets. 

Aside from its general use as food wrapping paper, rice sheets can also be eaten on their own! You can deep fry them and make fried paper chips. Another snack idea is to turn a rice paper sheet into a crispy, thin pizza. They also work as rice noodles in a pinch if you can’t find any ramen noodles or actual rice noodles in the grocery store. 

Rice paper is a translucent sheet that comes in different types. There are sheets used to make arts and crafts, some are used to preserve documents, while other types have found uses in architecture. 

Aside from practical applications, rice sheets are also available in an edible variety. Generally, they’re used for wrapping fillings in recipes such as spring rolls, summer rolls, or dumplings. They can also be eaten on their own. Rice sheets are healthy to consume as they contain fewer calories, are low in fat, and have no cholesterol.

Hui Yin moved from Hong Kong 🇭🇰 to the USA 🇺🇸 when she was just 8 years old. Now in her late 20's she enjoys writing and taking long walks in the park to burn off the copious amounts of rice she eats for dinner.

• Black + Decker
• Hamilton Beach
• Joseph Joseph
• Rice Cookers
• Tevo Technics

Site Navigation

• Accessibility Standards
• Testimonials
• Advertise with us

Useful Links

• Complaints Policy
• Code of Ethics
• Cookies Policy
• Editorial Policy
• Legal Disclaimer
• Modern Slavery Statement
• Privacy Policy
• Terms of Service

Welcome to WeKnowRice. We’re a news, analysis, review, and opinion platform for everything related to rice and rice cookers.

NOTE: As an Amazon Associate, this website earns from qualifying purchases. Our posts may include Amazon Associate links throughout.

Email: [email protected]

2023 Copyright (C) WeKnowRice.com

• Printing Reviews
• Printing Techniques
• Binding Types

What is rice paper? Characteristics and types

Rice paper is a type of paper which, as its name suggests, is made from different parts of the rice plant such as straw or flour, used especially in oriental cuisine.

It can also refer to other types of paper made from plants such as hemp or bamboo.

Table of Contents

Types of rice paper What are they used for?

When you search the internet for the term “rice paper”, do you find it difficult to find exactly the paper you need? This is because the term has multiple origins for different types of paper that have different uses.

Following are four completely different types of paper that have different uses, but are called rice paper:

Paper made from the rice paper plant : No, there is no paper made from the rice plant. In the early 20th century, a type of paper made from the Tetrapanax papyrifer plant was imported to Europe from Asia.

This paper was commonly, but erroneously, called “rice paper” because of its Asian origins and bright white colour. It is commonly used for making artificial flowers, as a shoe sole and for painting. However, it is not commonly used for writing.

Edible paper : In the food industry, there is a thin, starchy, edible paper used for wrapping Vietnamese food. This food wrapping paper is often referred to as rice paper, or nem wrappers.

This paper can be made from rice starch, but other ingredients such as tapioca starch, milk and bananas can be added for flavour and texture.

Rice paper for art, architecture and writing : Papers from Asian countries are often labelled with the generic term rice paper. The paper can originate from many different countries and is often made from different pulp and fibre ingredients.

The most common source of pulp for rice paper is the different varieties of mulberry. Other plants, such as the Lokta shrub, are also used due to its wide distribution in the country of origin.

Craft rice paper

If you are looking for rice paper for art, lampshades, shoji shades or other creative applications, there are several types of paper that you may find useful. Here are different types of paper that are often referred to as “rice paper”:

Thai mulberry paper : The Thais have perfected the mass production of mulberry paper. After carefully preparing the bark strands, artisans handcraft mulberry paper of all sizes and weights. Unryu paper is soft and translucent, while heavyweight mulberry papers provide stiffness and texture.

Washi paper from Japan : Washi paper is a highly refined mulberry paper. Japanese craftsmen have elevated ordinary mulberry paper to the status of art.

One branch of Japanese papermaking focuses on taking mulberry, mitsumata and gampi papers and turning them into papers of such high quality that they are used in book and document conservation efforts. The conservation papers are flawless and so thin that they are virtually transparent when used to repair books.

Another branch of Japanese papermaking uses mulberry paper to display intricate and artistic designs. Chiyogami or Yuzen paper features beautiful and colourful designs. Each colour of the design is meticulously silk-screened by hand onto the sheet. After 8 or 9 applications of screen printing, the depth of colour is astonishing.

Korean Hanji paper : Korean rice paper is formally known as Hanji paper. Hanji paper is traditionally used for legal and important documents that must last for a long time. Hanji paper achieves this durability by adding Hibiscus meniot to the paper pulp. The meniot provides additional strength to the fibres so that they do not break over time. In addition, the pulp mixture does not contain any acid, which makes Hanji paper an ideal archival paper.

Nepal Lokta Paper : Lokta bush is more common in Nepal than mulberry. The bark of the Lokta shrub is used to make paper pulp in the same way that mulberry is used in Thailand, Japan and Korea. Nepalese artisans have become famous not only for making paper, but for converting that paper into useful paper products and ornaments such as bags and rosettes. Like its cousins, Lokta paper is often misnamed “rice paper”.

Japanese Shoji paper : Another common use of rice paper is in architecture. It can be found in Japanese Shoji screens and as a translucent lampshade. Shoji paper is a thin, semi-translucent mulberry paper that is often left natural white or bleached. It is placed in lampshade frames and moistened. When dry, the paper shrinks. Held firmly in the screen frame, the paper becomes smooth and taut.

Chinese Xuan Paper : Finally, rice paper made in China is called Xuan paper. It was originally made from the bark of the Pteroceltis Tatarinowii tree (a relative of the elm). Over the years, other pulps such as mulberry, bamboo and rice made their way into the Chinese paper industry.

Leave a Reply Cancel reply

Your email address will not be published. Required fields are marked *

Save my name, email, and website in this browser for the next time I comment.

Current ye ignore me @r *

Leave this field empty