new research on herpes virus

We thought herpes was untreatable. Now, that might change

“Herpes is very sneaky. It hides out among nerve cells and then reawakens and causes painful skin blisters,” said  Keith Jerome, MD, PhD , professor in the Vaccine and Infectious Disease Division at Fred Hutch. “Our aim is to cure people of this infection, so that they don’t have to live with the worry of outbreaks or of transmitting it to another person.”

Published May 13 in  Nature Communications , Jerome and his Fred Hutch team report an encouraging step toward a gene therapy for herpes.

The experimental gene therapy involves injecting into the blood a mixture of gene editing molecules that seek out where the herpes virus resides in the body. The mixture includes laboratory-modified viruses called a vector — commonly used in gene therapies — plus enzymes that work like molecular scissors. Once the vector reaches the clusters of nerves where the herpes virus hangs out, the molecular scissors snip away at the herpes virus’s genes to damage them or remove the virus entirely.

“We are using a meganuclease enzyme that cuts in two different places in the herpes virus’s DNA,” said first author  Martine Aubert, PhD , principal staff scientist at Fred Hutch. “These cuts damage the virus so much that it can’t repair itself. Then the body’s own repair systems recognize the damaged DNA as foreign and get rid of it.”

Using mouse models of the infection, the experimental therapy eliminated 90% of herpes simplex virus 1 (HSV-1) after facial infection, also known as oral herpes, and 97% of herpes HSV-1 after genital infection. It took about a month for the treated mice to show these reductions, and the reduction of virus seemed to get more complete over time.

In addition, the researchers found that the HSV-1 gene therapy had a significant reduction in both the frequency and amount of viral shedding.

“If you talk to people living with herpes, many are worried about whether their infection will transmit to others,” Jerome said. “Our new study shows that we can reduce both the amount of virus within the body and how much virus is shed.”

The Fred Hutch team also simplified their gene editing treatment, making it safer and easier to make. In a  2020 study , they used three vectors and two different meganucleases. The latest study uses just one vector and one meganuclease capable of cutting the virus DNA in two places.

“Our streamlined gene editing approach is effective at eliminating the herpes virus and has less side effects to the liver and nerves,” Jerome said. “This suggests that the therapy will be safer for people and easier to make, since it has fewer ingredients.”

While the Fred Hutch scientists are encouraged by how well the gene therapy works in animal models and are eager to translate the findings to treatments for people, they are also careful about the steps needed to prepare for clinical trials. They also noted that though the current study examined HSV-1 infections, they are working on adapting the gene editing technology to target HSV-2 infections.

“We’re collaborating with numerous partners as we approach clinical trials so we align with federal regulators to ensure safety and effectiveness of the gene therapy,” Jerome said. “We deeply appreciate the support of herpes advocates as they share our vision for curing this infection.”

Herpes simplex virus (HSV) is a common infection that lasts a lifetime once people are infected. Current therapies can only suppress but not completely eliminate symptoms, which include painful blisters. According to the  World Health Organization , an estimated 3.7 billion people under the age of 50 (67%) have HSV-1, which causes oral herpes. An estimated 491 million people aged 15-49 (13%) worldwide have HSV-2, which causes genital herpes.

Herpes can create other harms to people’s health. HSV-2 increases the risk of acquiring HIV infection. Other studies have linked dementia with HSV-1.

The work was funded by the National Institutes of Health, the Caladan Foundation and more than 2,000 individual donors. The meganucleases used in this research are derivatives of commercially-available meganucleases.

Note: Scientists at Fred Hutch played a role in developing these discoveries, and Fred Hutch and certain of its scientists may benefit financially from this work in the future.

Read the original post here

GLP Podcasts & Podcast Videos More...

GLP podcast: Organic farming—solution to climate change or path to world hunger?

Glp podcast: youth cancer rates ‘soaring’ no. will ai help or harm mental health care confronting vaccine ‘rejectionists’, videos more....

Video: How Chinese firms finance litigation disrupting intellectual property in biotech and food distribution system

Bees & pollinators more....

Mosquito massacre: Can we safely tackle malaria with a CRISPR gene drive?

Are we facing an ‘Insect Apocalypse’ caused by ‘intensive, industrial’ farming and agricultural chemicals? The media say yes; Science says ‘no’

Dissecting claims about Monsanto suing farmers for accidentally planting patented seeds

Infographics more....

Infographic: Global regulatory and health research agencies on whether glyphosate causes cancer

Gmo faqs more....

Why is there controversy over GMO foods but not GMO drugs?

How are GMOs labeled around the world?

How does genetic engineering differ from conventional breeding?

Alex Jones: Right-wing conspiracy theorist stokes fear of GMOs, pesticides to sell ‘health supplements’

IARC (International Agency for Research on Cancer): Glyphosate cancer determination challenged by world consensus

Most popular.

Newsletter Subscription

• Weekly Newsletter (Wed)
• Daily Digest (Mon, Tue, Thu, Fri)
• Weekly Top Six (Sun)
• Featured Articles Only
• Human Articles Only
• Agriculture Articles Only
• All Types of Content

Get news on human & agricultural genetics and biotechnology delivered to your inbox.

Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.

• View all journals
• Explore content
• About the journal
• Publish with us
• Sign up for alerts
• Open access
• Published: 17 September 2024

Viral gene drive spread during herpes simplex virus 1 infection in mice

• Marius Walter   ORCID: orcid.org/0000-0002-2476-9661 1 , 2 ,
• Anoria K. Haick 1 ,
• Rebeccah Riley   ORCID: orcid.org/0000-0002-5870-6837 2 ,
• Paola A. Massa 1 ,
• Daniel E. Strongin 3 ,
• Lindsay M. Klouser   ORCID: orcid.org/0000-0002-9644-361X 1 ,
• Michelle A. Loprieno   ORCID: orcid.org/0000-0002-2905-485X 1 ,
• Laurence Stensland 3 ,
• Tracy K. Santo 3 ,
• Pavitra Roychoudhury   ORCID: orcid.org/0000-0002-4567-8232 1 , 3 ,
• Martine Aubert   ORCID: orcid.org/0000-0003-1125-6856 1 ,
• Matthew P. Taylor 4 ,
• Keith R. Jerome   ORCID: orcid.org/0000-0002-8212-3789 1 , 3 &
• Eric Verdin   ORCID: orcid.org/0000-0003-3703-3183 2  

Nature Communications volume  15 , Article number:  8161 ( 2024 ) Cite this article

12 Altmetric

Metrics details

• Herpes virus
• Viral vectors

Gene drives are genetic modifications designed to propagate efficiently through a population. Most applications rely on homologous recombination during sexual reproduction in diploid organisms such as insects, but we recently developed a gene drive in herpesviruses that relies on co-infection of cells by wild-type and engineered viruses. Here, we report on a viral gene drive against human herpes simplex virus 1 (HSV-1) and show that it propagates efficiently in cell culture and during HSV-1 infection in mice. We describe high levels of co-infection and gene drive-mediated recombination in neuronal tissues during herpes encephalitis as the infection progresses from the site of inoculation to the peripheral and central nervous systems. In addition, we show evidence that a superinfecting gene drive virus could recombine with wild-type viruses during latent infection. These findings indicate that HSV-1 achieves high rates of co-infection and recombination during viral infection, a phenomenon that is currently underappreciated. Overall, this study shows that a viral gene drive could spread in vivo during HSV-1 infection, paving the way toward therapeutic applications.

Similar content being viewed by others

Gene editing and elimination of latent herpes simplex virus in vivo

Viral gene drive in herpesviruses

Gene editing for latent herpes simplex virus infection reduces viral load and shedding in vivo

Introduction.

Herpesviruses are ubiquitous pathogens that establish lifelong infections and persistently infect most of the human population. Their large dsDNA genomes (100–200 kb) replicate in the nucleus and encode hundreds of genes. After primary infection, herpesviruses enter latency and occasionally reactivate, causing recurrent disease. Herpes simplex viruses (HSV) 1 and 2 first infect mucosal surfaces before spreading to the nervous system via axons. The viral genome remains latent in neurons in sensory and autonomic ganglia. Periodic reactivation typically causes lesions in the facial or genital areas, which can be highly painful and stigmatizing. In addition, herpes encephalitis can be life-threatening in newborns and immunocompromised individuals 1 , 2 , and HSV-2 is a major risk factor for HIV acquisition 3 . Antiviral drugs like acyclovir can block viral replication and reduce symptoms, but cannot eradicate the latent reservoir. HSV-1 and 2 lack vaccines or curative treatments and new therapeutic strategies for HSV diseases are critically needed.

During an infection, cells are often co-infected by several virions and therapeutic approaches that rely on viral co-infection have great potential. These viral interference strategies rely on defective viral particles that interfere with the replication of wild-type viruses after co-infection, thus reducing viral levels 4 . Most viral interference approaches have focused on RNA viruses such as SARS-CoV-2, RSV, Influenza, Zika, Chikungunya, or HIV 5 , 6 , 7 , 8 , 9 , 10 . We recently developed a system of viral interference against herpesviruses, using a technique of genetic engineering known as a gene drive 11 , 12 . Gene drives are genetic modifications designed to spread efficiently through a population 13 , 14 . They usually rely on CRISPR-mediated homologous recombination during sexual reproduction to efficiently spread a transgene in a population, and applications have been developed in insects to eradicate diseases such as malaria 13 , 14 . By contrast, the viral gene drive that we invented spread by the co-infection of cells with wild-type and engineered viruses (Fig.  1a ). Specifically, upon co-infection with a gene drive virus expressing CRISPR-Cas9, the wild-type genome is cut and repaired by homologous recombination, producing new recombinant gene drive viruses that progressively replace the wild-type population. In a proof-of-concept study with human cytomegalovirus (hCMV), we previously showed that a viral gene drive propagated efficiently in cell culture in a population of unmodified viruses 11 . Importantly, an attenuated gene drive virus could spread efficiently until the wild-type population had been eliminated, ultimately reducing viral levels. This represented a new way to engineer herpesviruses for research or therapeutic purposes.

a Gene drive viruses carry Cas9 and a gRNA targeting the same location in a wild-type genome. After coinfection of cells by wild-type (WT) and gene drive (GD) viruses, Cas9 cleaves the wild-type sequence and homology-directed repair –using the gene drive sequence as a repair template– causes the conversion of the wild-type locus into a new gene drive sequence and the formation of new recombinant gene drive viruses (rGD). Artwork was modified from ref. 11 , 12 . b Modified and unmodified UL37-38 region. The gene drive cassette was inserted between the UL37 and UL38 viral genes and was composed of spCas9 under the control of a CBH promoter followed by the SV40 polyA signal, a CMV promoter driving an mCherry reporter, followed by the beta-globin polyA signal, and a U6-driven gRNA. c Localizations of the gene drive sequence and YFP/CFP reporters on HSV-1 genomes. GD represents a functional gene drive virus, GD-ns carries a non-specific gRNA, and Cas9 is deleted in GD-ΔCas9. UL/US: unique long/short genome segments. d , e Recombination products and examples of viral plaques after cellular co-infection with HSV1-WT expressing YFP and gene drive viruses expressing mCherry and CFP. Representative images from more than n > 10 experiments. Scale bars: 100 μm.

The spread of a viral gene drive relies on cellular co-infection events, which occur at a high frequency in cell culture experiments. While numerical simulations suggest that a viral gene drive could still spread with low co-infection rates 11 , the frequency of co-infection events during animal or human infections is poorly characterized. In mice, high levels of recombination are observed during herpes simplex encephalitis 15 , 16 , and attenuated viruses –which individually are harmless– can complement each other and cause severe disease 17 , 18 . Moreover, HSV strains circulating in humans exhibit evidence of extensive recombination 19 , 20 , 21 , 22 . These indirect observations suggest that cells are often co-infected by several virions during HSV-1 infection. However, whether a viral gene drive could propagate in vivo remains unknown.

In the present study, we tested if a viral gene drive could spread in animal models of herpesvirus infection. HSV-1 is an important human pathogen with established infection protocols in mice, and we developed a gene drive that targeted a neutral region in the HSV-1 genome. This design was not intended to impact viral fitness or limit viral spread, but to investigate the potential of the technology in vivo. Our results show that a gene drive could spread efficiently during acute HSV-1 infection, particularly in neuronal tissues. Using fluorescently labeled viruses, we directly observed high levels of cellular co-infection in the brain. Finally, we show evidence that a superinfecting gene drive virus could recombine with wild-type genomes during latent infection, paving the way toward therapeutic applications.

Design of a gene drive against HSV-1

We aimed to build a gene drive that would not affect viral infectivity and could spread efficiently into the wild-type population. We designed a gene drive targeting an intergenic sequence between the UL37 and UL38 genes, a region known to tolerate the insertion of transgenes with little or no impact on viral replication in cell culture and in vivo 23 , 24 . We created a donor plasmid containing homology arms, Cas9 (from Streptococcus pyogenes ) under the CBH promoter, an mCherry fluorescent reporter under the CMV promoter, and a U6-driven guide RNA (gRNA) targeting the intergenic UL37 - UL38 region (Fig.  1b ). Importantly, to prevent self-cleaving, introduction of the gene drive cassette removed the gRNA target sequence from the construct. To create the gene drive virus (GD), Vero cells were co-transfected with purified HSV-1 viral DNA and the gene drive donor plasmid, and mCherry-expressing viruses created by homologous recombination were isolated by three rounds of plaque purification until a pure population was obtained. To follow recombination events between viral genomes, the gene drive virus also carried a cyan fluorescent reporter ( CFP ) inserted into another neutral region between the US1 and US2 viral genes 15 , 25 (Fig.  1c ). Similarly, we built two control viruses with non-functional CRISPR systems, one with a non-specific gRNA (GD-ns) that did not target HSV-1, and one without Cas9 (GD-ΔCas9). Finally, to be used as a wild-type virus with an unmodified UL37-UL38 region, we generated a virus expressing a yellow fluorescent reporter (YFP) from the same US1-US2 region, hereafter referred to as HSV1-WT or simply WT (Fig.  1c ). All the viruses described here originated from the highly neurovirulent HSV-1 strain 17 + .

CRISPR technology presents the risk of off-target editing of the host genome. The gRNA targeting the HSV-1 UL37-UL38 intragenic region was designed to minimize off-target editing of the mouse genome. Amplicon sequencing of 14 putative off-target sites after infection of mouse cells with GD or GD-ns confirmed the high specificity of the gRNA. Only one locus showed evidence of off-target editing significantly above background, with a limited mutation rate of 0.02% (Supplementary Fig.  1 ).

Recombination between gene drive and wild-type genomes can result in four different genome configurations expressing the different fluorescent reporters, which can be followed by plaque assay (Fig.  1 d, e). In highly susceptible cell lines such as Vero cells, viral plaques originate from single virions, which allows reconstituting the recombination history of individual viral genomes. Plaques expressing YFP only, or CFP and mCherry together, represent the original WT and gene drive viruses, respectively, while plaques expressing CFP only, or YFP and mCherry together, represent recombination products that exchanged the gene drive cassette.

Gene drive spread in cell culture

First, we tested if our gene drive could spread in vitro and conducted co-infection experiments in cell culture. Some cell lines, in particular Vero cells or other epithelial cells, efficiently restrict co-infection by a mechanism known as superinfection exclusion 26 , 27 . However, we found that mouse neuronal N2a cells could sustain high levels of co-infection (Supplementary Fig.  2 ). Thus, co-infection experiments were conducted in N2a cells, while plaque assays were performed in Vero cells. Importantly, the WT, GD, GD-ns and GD-ΔCas9 viruses individually replicated with similar dynamics in N2a cells, showing that insertion of the gene drive cassette in the UL37-UL38 region did not affect infectivity in cell culture, as expected (Fig.  2a ).

a Viral titers in the supernatant after infection of N2a cells with WT, GD, GD-ns or GD-ΔCas9. Cells were infected with a single virus at MOI = 1. n  = 4. b , c Viral titers in the supernatant after co-infection of N2a cells with WT + GD, WT + GD-ns or WT + GD-ΔCas9, with a starting proportion of gene drive virus of 20% ( b ) or 40% ( c ). MOI = 1, n  = 4. d – g Evolution of the viral population after co-infection with WT + GD, WT + GD-ns or WT + GD-ΔCas9, with a starting proportion of gene drive virus of 20% ( d , e ) or 40% ( f , g ). Panels ( d and f ) show the proportion of viruses expressing mCherry, representing gene drive virus. Panels ( e and g ) show the proportion of viruses expressing the different fluorophore combinations. Viral titers are expressed in log-transformed PFU (plaque-forming unit) per mL of supernatant. Error bars represent the standard error of the mean (SEM) between biological replicates. n  = 4. Source data are provided as a Source Data file.

To test if the gene drive could efficiently spread in the viral population, N2a cells were co-infected with WT + GD, WT + GD-ns, or WT + GD-ΔCas9. Cells were infected at a combined MOI of 1 with an initial proportion of gene drive virus of 20% (Fig.  2 b, d, e). Titers and proportion of progeny viruses expressing the different fluorescent markers were measured by plaque assay, from day one to day three post-infection. For each combination tested, the dynamics of total viral replication were indistinguishable from WT-only infection (Fig.  2b ). However, the composition of the viral population changed over time. The proportion of viruses expressing mCherry, which represents gene drive viruses, increased from 20% to 85% when cells were co-infected with WT + GD (Fig.  2d ). Importantly, YFP-only viruses disappeared and were replaced by recombinant viruses expressing both YFP and mCherry, representing 45% of the final population (Fig.  2e ). This indicated that the WT population had been converted to new recombinant gene drive viruses, as anticipated. The proportion of viruses expressing both CFP and mCherry, which represent the original gene drive virus, increased slightly from 20% to 40% (Fig.  2e ). By contrast, in the control experiments with GD-ns or GD-ΔCas9, the proportion of mCherry-expressing viruses did not change and remained close to its initial value of 20% (Fig.  2d ). In these control experiments, around 10% of viruses expressed both YFP and mCherry at day 3, but this population of recombinant viruses was mirrored by viruses that had lost mCherry and expressed CFP only (Fig.  2e ). These represented viruses that had exchanged their YFP and CFP regions in a nonspecific manner. Importantly, CFP-only viruses were not observed after co-infection with WT + GD, highlighting that the efficient incorporation of the gene drive cassette into unmodified genomes is a unilateral and targeted process requiring both Cas9 and a specific gRNA.

To confirm these observations, we repeated these co-infection experiments with an initial proportion of gene drive virus of 40% (Fig.  2 c, f, g). With this higher starting point, the gene drive achieved almost complete penetrance and the proportion of mCherry-expressing viruses reached 95% after 3 days, with the population of wild-type viruses expressing YFP-only being converted to recombinant gene drive viruses expressing both YFP and mCherry. As observed above, in the WT + GD-ns or WT + GD-ΔCas9 control experiments, the proportion of mCherry-expressing viruses remained constant at around 40%, and approximately 15% of YFP+mCherry and CFP-only viruses symmetrically appeared by CRISPR-independent recombination. This further showed that a gene drive could spread efficiently in the wild-type population and that the drive was mediated by a functional CRISPR system.

Together, these results indicated that a gene drive could be designed against HSV-1 and spread efficiently in cell culture. Importantly, both during single and co-infections, viral growth of WT and GD viruses followed similar dynamics and the proportion of viruses expressing CFP remained constant (Fig.  2 ). Thus, the rapid increase of recombinant viruses expressing both mCherry and YFP could not be explained by a higher fitness of the GD virus, but resulted from efficient CRISPR-directed homologous recombination. These results align with the findings of a parallel study 28 and expanded on our previous work with hCMV, showing that a viral gene drive could be developed in a second, unrelated, herpesvirus.

Gene drive spread during herpes encephalitis

Next, we tested if the gene drive could spread during acute HSV-1 infection in mice. Previous studies showed that HSV-1 naturally sustains high levels of recombination in the mouse brain during herpes simplex encephalitis 15 . Thus, we hypothesized that a gene drive could spread efficiently in this context. We used a well-established infection model, where HSV-1 is inoculated intravitreally in the eye and infects the retina and other ocular tissues before propagating to the nervous system via cranial nerves (Fig.  3a ). Specifically, HSV-1 travels to the brain via the optic, oculomotor and trigeminal nerves (cranial nerves CN II, III, and V, respectively), either directly or indirectly by first infecting ganglionic neurons of the peripheral nervous system. In particular, HSV-1 infects the trigeminal ganglia (TG) before reaching the brain stem. In the following experiments, a total of 10 6 plaque-forming units (PFU) were inoculated intravitreally in the left eye, and tissues were collected, dissociated, and analyzed by plaque assay after four days. Five to eight-week-old male and female Balb/c mice were used and we did not observe any differences between sexes. Importantly, individual infections with WT, GD or GD-ns reached similar titers in the eye, the TG and the brain, showing that the gene drive cassette in the UL37-UL38 region did not impact infectivity in vivo (Fig.  3b ).

a Infection routes along the optic, oculomotor and trigeminal nerves (cranial nerves II, III and V, respectively) following ocular inoculation of HSV-1. Male and female Balb/c mice were infected with 10 6 PFU in the left eye. b, c Viral titers after four days in the eye, TG and whole brain after ( b ) infection with a single virus, n  = 5 mice, or ( c ) with a starting proportion of gene drive virus of 15%, n  = 6 mice. d , e Viral population in the eye, TG and whole brain after co-infection with WT + GD or WT + GD-ns, after four days. n  = 6. f Proportion of viral genomes with a mutated target site in the brain after four days. n  = 3. g Viral titers in the spinal cord and brain after inoculation of WT, WT + GD, or WT + GD-ns in the right hind leg footpad, after 5–7 days. n  = 8 for WT and WT + GD, n  = 4 for WT + GD-ns. h , i Viral population in the spinal cord and whole brain after co-infection with WT + GD or WT + GD-ns, after 5–7 days. n  = 5 for WT + GD, n  = 1 for WT + GD-ns. Viral titers are expressed in log-transformed PFU. In panels ( b , c and g ) black lines indicate the median. n.d.: non-detected. Panels ( d , e , f , h, and i ) show the average and SEM between biological replicates. Source data are provided as a Source Data file.

To test if the gene drive could efficiently spread in vivo, mice were inoculated intravitreally with WT only, WT + GD, or WT + GD-ns, with an initial proportion of gene drive virus of 15% (Fig.  3c–e ). Total viral titers in the eye, TG and brain after four days were indistinguishable between the different conditions, showing that the gene drive did not perturb the overall dynamics of infection (Fig.  3c ). The population of gene drive viruses expressing mCherry increased from 15% to 30% in the eye, to 60% in the TG, and 70% in the brain, respectively. We observed a high variation between replicates, with the percentage of gene drive viruses in the brain ranging from 50% to 90%, with a median of 77% (Fig.  3d ). Furthermore, and as observed in cell culture, wild-type viruses expressing YFP-only were converted to recombinant gene drive viruses expressing YFP and mCherry, representing 40% of the final population. The proportion of original gene drive viruses expressing CFP and mCherry increased slightly, from 15% to 20% in the TG, and 30% in the brain, respectively (Fig.  3e ). Critically, in the control experiment with GD-ns, the proportion of gene drive viruses did not change and remained close to its initial value around 15% in all tissues, with a similar proportion of YFP+mCherry and CFP-only viruses appearing by CRISPR-independent recombination (Fig.  3e ). Altogether, this important result showed that the gene drive efficiently spread in the viral population as the infection progressed to the brain, with recombinant gene drive viruses increasing from 15% to 70% in four days.

Gene drive propagation relies on efficient homologous recombination after CRISPR cleavage, but DNA double-strand breaks can also be repaired by non-homologous end joining (NHEJ), resulting in small insertions and deletions that render viruses resistant to the drive 12 , 28 . After PCR and Sanger sequencing of infectious viruses isolated from the brain, we found that 20% of the remaining target sites had been mutated by NHEJ (Fig.  3f ). Since the gene drive represented 70% of viruses at this point, this result suggested that drive-resistant viruses represented around 6% of the total viral population. This indicated that the drive did not achieve full penetrance after four days, and confirmed the observation made with hCMV that mutagenic repair by NHEJ is infrequent compared to homologous recombination during gene drive spread 11 , 12 .

We next tested if our gene drive could spread in another infection model, where HSV-1 is inoculated in the hind leg footpad. In this model, HSV-1 travels to the spinal cord via the sciatic nerve, and finally to the brain. 10 6 PFU of WT, WT + GD or WT + GD-ns were inoculated in the right hind footpad, with an initial proportion of gene drive virus of 15%. Tissues were collected five to seven days later and analyzed by plaque assay (Fig.  3g–i ). Around half the mice did not show any symptoms of infection and had no detectable virus in the spinal cord and the brain, while others developed severe neurological symptoms with very high titers in both tissues (Fig.  3g ). In animals with detectable virus, the average proportion of gene drive viruses reached 60% in the brain, with a range between 30% and 80%, and 50% in the spinal cord (Fig.  3h ). Once again, wild-type viruses expressing YFP-only had been converted to recombinant gene drive viruses expressing both YFP and mCherry, while the population of viruses expressing CFP and mCherry remained constant (Fig.  3i ). Only one control animal infected with WT + GD-ns developed a detectable infection, with mCherry-expressing viruses reaching 35% in the spinal cord. These results confirmed that a gene drive could spread after inoculation via a second route of HSV-1 infection.

Altogether, these findings showed that a gene drive could propagate efficiently in vivo during acute HSV-1 infection in mice, and that the drive was mediated by a functional CRISPR system.

High heterogeneity during gene drive spread in the brain

HSV-1 travels to the brain via different neuronal pathways, and we hypothesized that following gene drive propagation in different regions of the brain could bring novel insight into the dynamics of HSV-1 infection and recombination. After intravitreal inoculation, HSV-1 infects retinal neurons and travels via the optic nerve (CN II) to the hypothalamus and the thalamus –both part of the interbrain– before reaching the cortex through visual pathways. Secondary branches of the optic nerve also connect to the midbrain –the rostral part of the brain stem. After infecting other ocular tissues and specifically the ciliary ganglion, HSV-1 separately reaches the midbrain via the oculomotor nerve (CN III). Finally, HSV-1 travels via the trigeminal nerve (CN V) to the TG and then to the brain stem (Fig.  4a ).

a Infection routes following ocular inoculation of HSV-1. Male and female Balb/c mice were co-infected with 10 6 PFU of WT + GD in the left eye, with a starting proportion of gene drive virus of 15%. b Viral titers over time. Black lines indicate the median. n.d.: non-detected. c , d Proportion of gene drive viruses over time. Data show the average and SEM between biological replicates. e Heatmap summarizing panels ( b and c ). n  = 4 mice for day 2 and 3, n  = 6 mice for day 4. Source data are provided as a Source Data file.

To investigate tissue-specific differences in gene drive propagation, Balb/c mice were inoculated intravitreally with 10 6 PFU of WT + GD, with an initial proportion of gene drive virus of 15%. Viral titers and gene drive-directed recombination were measured by plaque assay in the eye, TG, brain stem, interbrain, cortex and cerebellum at days two to four post-infection (Fig.  4 ). Viral titers increased progressively throughout the brain, first reaching the interbrain and brain stem after 2 days and then spreading to the cortex and cerebellum (Fig.  4b and summary heatmap in Fig.  4e , upper panel). As described above, the proportion of gene drive viruses remained low in the eye and reached around 60% in the TG (Fig.  4c–e ). Interestingly, gene drive levels varied greatly between the different brain regions. The gene drive reached 80% in the brain stem after only two days, and progressively increased to 65% in the interbrain and cerebellum, with a penetrance of up to 90% in some animals. By contrast, gene drive levels remained low in the cortex, at 25% on average. As observed above, in the TG, brain stem and interbrain –but not in the eye and cortex, viruses expressing YFP-only had been converted to recombinant gene drive viruses expressing both YFP and mCherry (Fig.  4d ). Together, this showed that gene drive spread in the brain was highly heterogeneous, with almost complete penetrance in some regions and barely any in adjacent ones.

This heterogeneity gives an interesting insight into the dynamic of HSV-1 infection. Gene drive propagation relies on cellular co-infection and one intuitive hypothesis is that higher viral levels would increase the probability that cells are co-infected by several virions, and, thus, that recombination levels should positively correlate with viral titers. However, no correlation between viral titers and recombination was observed (Supplementary Fig.  3 ). For example, HSV-1 levels were the highest in the eye, but gene drive levels remained the lowest in this organ. Similarly, HSV-1 reached similar titers in the brain stem, interbrain and cortex, but almost no recombination occurred in the cortex while high levels were observed in the brain stem and interbrain (Fig.  4d ). This shows that recombination does not simply correlate with viral titers, as could be expected, but is likely explained by other tissue-specific cellular or viral mechanisms.

High levels of cellular co-infection in the TG and the brain

The results described above suggest that cells are frequently co-infected by several virions during HSV-1 infection. Thus, we aimed to directly measure co-infection levels during HSV-1 infection, as this would provide important insight into the basic biology that supports gene drive propagation.

HSV-1 and related viruses expressing fluorescent proteins have long been used to probe neuronal pathways of the visual system 29 , 30 , 31 . To investigate cellular co-infection, Balb/c mice were infected ocularly with equal amounts of three different viruses, expressing either YFP, CFP or RFP from the same US1/US2 locus (Fig.  5a ). The fluorescent reporters carried nuclear localization signals and were not incorporated into virions, and, thus, marked infected nuclei. Mice were injected intravitreally with a total of 10 6 PFU in the left eye and dissected four days later. Fluorescence was observed directly on frozen sections without staining. Strikingly, we observed very high levels of co-infection in the TG (Fig.  5 ) and different regions of the brain (Fig.  6 ), with cells often co-expressing two or more fluorophores.

a Balb/c mice were co-infected with equivalent amounts of three viruses expressing YFP, CFP and RFP, respectively, with a total of 10 6 PFU in the left eye. b . YFP and CFP cellular intensity after machine learning-assisted cell segmentation of TG sections. Datapoints represent individual cells and were colored by converting YFP and CFP signals into the CYMK color space. 4035 cells were detected, originating from 53 images and n = 4 mice. c Percentage of infected cells expressing YFP, CFP, or both. n = 4 mice. d Percentage of infected cells expressing one or two fluorescent markers. n = 4 mice. e, f Representative images of TG sections from four biological replicates, highlighting high levels of co-infection. Arrows indicate cells co-expressing YFP, CFP and RFP together. Scale bars: 100 μm. Panels ( c and d ) show the average and standard deviation (SD) between biological replicates. Source data are provided in Supplementary data  2 and as a Source Data file.

a Images of brain sections were collected in three regions in the thalamus, midbrain and brain stem after ocular infection. b YFP, CFP and RFP cellular intensity after machine learning-assisted cell segmentation of brain sections. Datapoints were colored by converting YFP, CFP and RFP signals into the CYMK color space. 10,028 cells were detected, originating from 95 images and n  = 3 mice. c Percentage of infected cells expressing one, two, or three fluorescent markers, both in the whole brain and in specific subregions. n  = 3 mice. Data show the average and SD between biological replicates. d Representative images of the brain in the thalamus (sections S1), midbrain (sections S2) and brain stem (section S3), from three biological replicates. e – h Representative images and summary of co-infection patterns in specific subregions. LGN: lateral geniculate nucleus; SC: superior colliculus; EW: Edinger–Westphal nucleus; TGN: trigeminal nerve nuclei. Scale bars: 100 μm. Source data are provided in Supplementary data  2 and as a Source Data file.

In the TG, YFP and CFP were expressed at high levels, but the RFP signal was weaker and rarely above background. Thus, for the TG, we restricted our analysis to YFP and CFP. We observed widespread expression distributed over the entire length of the TG on some sections, or more tightly localized clusters in others (Fig.  5e , Supplementary Fig.  4e ). Areas with the strongest signal likely localized to the neuron-rich ophthalmic division of the TG, but the widely disseminated expression indicated that HSV-1 had spread to other areas. Importantly, a majority of infected cells appeared to express both YFP and CFP, indicating extensive cellular co-infection in the TG (Fig.  5e ). To quantify co-infection precisely, we used machine learning to automatically segment cells and measure YFP and CFP intensity on TG sections (Fig.  5 b– d , Supplementary Fig.  4a-d ). A total of 4035 cells was detected, with a clear separation between YFP and CFP signals and high consistency between replicates. We found that an average of 52% of cells expressed both YFP and CFP, with a range of 45% to 60% between replicates. Since RFP was excluded from this analysis, this was probably an underestimate of the co-infection frequency. In fact, in the few images with strong RFP signal, we detected numerous cells co-expressing RFP, YFP and/or CFP, with instances of cells expressing all three markers (Fig.  5f , Supplementary Fig.  4e ). Together, this showed that more than 50% of cells were co-infected by two or more virions in the TG.

We then repeated this analysis in the brain (Fig.  6 , Supplementary Figs.  5 – 10 ). We detected strong fluorescence along well-characterized routes through the optic, oculomotor and trigeminal nerves (Fig.  6d , Supplementary Fig.  5 ). In particular, fluorescence was observed: 1) in the lateral geniculate nucleus (LGN) in the thalamus and the superior colliculus (SC) in the midbrain, where most axons of the optic nerve terminate; 2) in the Edinger–Westphal nucleus (EW), one of the two nuclei of the oculomotor nerve in the midbrain; and 3) throughout the hindbrain, likely corresponding to trigeminal nerve nuclei (TGN). Fluorescence was also detected in other areas associated with visual pathways such as the optic tract, olivary pretectal nucleus, suprachiasmatic nuclei or visual cortex (Supplementary Fig.  5 ). Additionally, disseminated fluorescence was detected over wide areas not easily associated with the visual system, with important variation between replicates. This likely corresponded to the secondary or tertiary spread of HSV-1 throughout the brain. Images were collected in three main regions in the thalamus, midbrain, and hindbrain (Fig.  6a ). This time, RFP had a stronger signal and was included in the analysis. After machine learning-assisted segmentation, a total of 10,028 cells were analyzed over three brains. RFP was observed in 10-15% of infected cells, while YFP and CFP were detected in equivalent proportions in 40–60% of cells (Supplementary Fig.  6 ). When analyzing all images together, we observed a high level of co-infection. In total, 29% of cells expressed two colors, and 5% of cells had three colors, with results highly consistent between replicates (Fig.  6b, c and Supplementary Fig.  6 ). This confirmed the high level of co-infection found in the TG, with more than 34% of cells co-infected by two or more virions in the whole brain.

Next, we focused our analysis on the brain regions associated with primary HSV-1 spread, namely the LGN, SC, EW, and TGN. Interestingly, the LGN and SC, where the optic nerve terminates, had relatively low co-infection levels, around 20%. By contrast, the EW and TGN, where the oculomotor and trigeminal nerves terminate, respectively, had much higher co-infection levels, around 40% (Fig.  6c ). This visually correlated with very different infection patterns. In the LGN and SC, well-separated and tight foci expressing only one color were observed, with co-infected cells at the boundaries (Fig.  6e, f closeups and additional examples in Supplementary Figs.  7 and 8 ). This was reminiscent of viral plaques in cell culture and may suggest clonal spread from a single infected cell. By contrast, in the EW and TGN, infected cells were broadly disseminated, with few infected cells touching each other. The different colors were uniformly distributed and cells with one, two, or three colors were observed without evidence of spatial clustering (Fig.  6g, h , Supplementary Figs.  9 and 10 ). Together with the high heterogeneity observed during gene drive spread (Fig.  4 ), these observations suggested that co-infection dynamics vary significantly depending on the viral propagation route.

Finally, we analyzed co-infection levels in the eye (Fig.  7 , Supplementary Fig.  11 ). At this late stage of infection, HSV-1 replicated at very high titer and the eye retained poor physical integrity. Additionally, high background autofluorescence in the CFP and RFP channels made the interpretation of co-infection patterns challenging. Despite these caveats, we detected widespread infection in most ocular tissues, and in particular the retina and cornea (Fig.  7b , Supplementary Fig.  11a ). In the retina, fluorescent reporters appeared physically separated, forming non-overlapping stripes spanning the width of the retina (Fig.  7c , Supplementary Fig.  11a ). This suggested that HSV-1 spread from the upper to the deeper layers of the retina with limited amounts of co-infection. By contrast, we observed high levels of co-infection in a small posterior ocular structure that we identified as the ciliary ganglion (Fig.  7d–f , Supplementary Fig.  11b–g ). Co-infection levels in the ciliary ganglion were similar to those observed in the TG, with more than 50% of cells infected by two or more virions, suggesting that high levels of co-infection may be favored in all ganglia.

a Following intravitreal inoculation, HSV-1 principally infects the retina and other ocular tissues such as the cornea, before invading the peripheral and central nervous system. In particular, HSV-1 infects the ciliary ganglion (CG) before propagating to the midbrain through the oculomotor nerve. b Representative image of an infected eye, showing infected cells in the retina, cornea and CG. The boxed area is shown in panel ( c ). c Representative image of the retina. Despite the high background fluorescence in the CFP and RFP channels, viruses expressing YFP, CFP and RFP appear restricted to non-overlapping areas. d Representative image of the ciliary ganglion (CG), showing high levels of co-infection. The CG was identified as a small structure close to the optic nerve in the posterior region of the eye, with clear fluorescent signals similar to other neuronal tissues in the TG or the brain. e YFP, CFP and RFP intensity in the CG after machine learning-assisted cell segmentation. 222 cells originating from 4 images and n  = 2 mice. f Percentage of infected cells expressing one, two, or three fluorescent markers in the CG. n  = 2. Scale bars: 100 μm. In panels ( b , c , and d ,) images are representative images from two biological replicates. Source data are provided in Supplementary data  2 and as a Source Data file.

Altogether, this analysis revealed that neuronal tissues sustain high levels of co-infection during HSV-1 infection, with more than 50% and 40% of cells infected with two or more viruses in peripheral ganglia and specific brain regions, respectively. The differences in co-infection patterns between tissues and brain regions are intriguing and will form the basis of future investigations.

Gene drive spread during latent infection

Our results showed that a gene drive could spread efficiently during acute infection. Next, we investigated if a gene drive could also spread in the context of a latent infection, as this would open important avenues for therapeutic interventions. After primary oro-facial infection, HSV-1 typically establishes latency in the TG and other peripheral ganglia. Following reactivation, HSV-1 travels back to the mucosal surface, causing lesions or shedding asymptomatically. In the following experiments, we used an ocular model of latent infection and drug-induced reactivation in mice to test if a gene drive virus –administered at a later time point, thus “superinfecting”– could target and recombine with latent HSV1-WT (Figs.  8 and 9 ).

a Experimental outline: Swiss-Webster mice were infected with 10 5 PFU of HSV1-WT on both eyes after corneal scarification. Four weeks later, mice were superinfected with 10 7 PFU of GD or GD-ns on both eyes, after corneal scarification. Another four weeks later, latent HSV-1 was reactivated twice with JQ1, two weeks apart. n  = 14 mice per group. b Titer and number of shedding events in eye swabs on days 1–3 following JQ1 treatment, by qPCR. Shedding events from the same mouse are connected by a line. c Genotyping of positive eye swabs from five mice, using two duplex ddPCR assays. The first assay detected and quantified mCherry levels. The second assay distinguished between YFP and CFP . n  = 8. d Number and proportion of TG and mice with detectable CFP . e Latent viral load in the TG by duplex ddPCR, detecting mCherry , YFP , CFP markers, or all HSV sequences. n  = 28. f Proportion of CFP and mCherry in the TG. n  = 28. Titers are expressed in log-transformed copies per swab, or per million cells after normalization with mouse RPP30 levels. Black lines indicate the median. n.d.: non-detected. Source data are provided as a Source Data file.

C57Bl/6 mice were infected with 10 6 PFU of HSV1-WT on both eyes after corneal scarification. Four weeks later, mice were superinfected with 10 7 PFU of GD or GD-ns on both eyes, after corneal scarification. After another four weeks, latent HSV-1 was reactivated three times, two weeks apart, with JQ1 and Buparlisib. n  = 26 for GD, n  = 18 for GD-ns. a Titer and number of shedding events in eye swabs on days 1–3 following JQ1 treatment, by qPCR. Shedding events from the same mouse are connected by a line. b Genotyping of positive eye swabs, detecting mCherry , YFP and CFP markers. Light red indicates low mCherry levels, less than 5% of the total swab titer. Swab genotypes were assessed by ddPCR and confirmed by qPCR for low-titer swabs. Details are shown in Supplementary Fig.  14 . c Number and proportion of TG and mice with detectable CFP marker from GD/GD-ns. d , e Latent viral load and proportion in the TG. n  = 52 for GD, n  = 36 for GD-ns. Black lines indicate the median. f mCherry as a function of CFP . Data was fitted either to the best possible line or to the identity line, and the fits were compared using the extra sum-of-squares F test. GD datapoints were significantly higher than the identity line ( p  < 0.0001), suggesting gene drive propagation in the TG. Same data as panel ( d ), excluding non-detected samples. n  = 38 for GD, n  = 23 for GD-ns. g Log2 fold-change between the proportion of latent mCherry and CFP , using data from panel ( e ). Samples with low levels of less than 0.5% were excluded. Black lines show the average. Asterisks summarize the results of two-sided Welch’s t-test ( p  = 0.0053). n  = 33 for GD, n  = 20 for GD-ns. Titers are expressed in log-transformed copies per swab, or per million cells after normalization with mouse RPP30 . n.d.: non-detected. Source data are provided as a Source Data file.

To establish a latent infection, Swiss-Webster mice were infected ocularly with HSV1-WT, with 10 5 PFU in both eyes after corneal scarification. Four weeks later, animals were inoculated with GD or control GD-ns after corneal scarification (Fig.  8a , Supplementary Fig.  10a, b ). Immune responses induced by the primary infection limit the spread of a superinfecting virus, allowing mice to be safely inoculated with 10 7 PFU per eye of GD or GD-ns while being transiently immunosuppressed with the glucocorticoid dexamethasone. After four more weeks and once the second infection had resolved, latent HSV-1 –originating from the primary, secondary infection, or both– was reactivated twice by treating animals with the bromodomain inhibitor JQ1. Mice do not naturally reactivate HSV-1, but JQ1 induction reproducibly induces viral shedding 32 , 33 . Eye swabs collected on days 1-3 following JQ1 treatment were screened for viral DNA by qPCR. We observed overall low shedding rates. A total of 10 shedding events were detected, with some animals shedding on consecutive days (Fig.  8b ). Gene drive-directed recombination was measured in positive swabs using two duplex digital droplet (dd)PCR assays, that distinguish between the YFP , CFP and mCherry markers of WT and gene drive viruses and quantify the proportion of gene drive recombinants. Eight out of ten positive swabs could be successfully genotyped, with the gene drive sequence detected in three of them (Fig.  8c , Supplementary Fig.  12g ). Critically, one of the reactivated viruses (from mouse #24) was a recombinant gene drive virus carrying YFP and mCherry markers, whereas two others carried CFP and mCherry , representing the original gene drive virus. Despite the limited number of shedding events, this showed that GD and GD-ns could successfully reach the latent reservoir and later reactivate, with one recombination event detected.

Next, both TG from each animal were collected and latent viral loads were measured by duplex ddPCR. The CFP marker originating from the superinfecting GD or GD-ns viruses could be detected in around 40% of TG, with 60% of mice having detectable CFP in at least one TG (Fig.  8d ). When detected, GD and GD-ns viral loads were approximately two orders of magnitude lower than WT, as measured by the respective titers of YFP and CFP/mCherry (Fig.  8e ). Overall, GD and GD-ns represented between 0 and 60% of the total latent viral load (average around 5%, median at 0%), with most detected samples ranging from 1% to 10% (Fig.  8f ). This low proportion contrasted with the relatively high frequency of gene drive sequences detected in reactivated swabs (3/8, or 37%), suggesting that the superinfecting GD/GD-ns viruses could successfully reactivate and shed despite representing only a small proportion of the latent reservoir.

Swiss Webster mice are highly susceptible to HSV-1 infection. During primary infection, mice exhibited moderate to severe symptoms, with often extensive facial lesions. As a result, most animals had residual scar tissue on their eyes once the primary infection had resolved. Symptoms and final eye scarification were scored during the primary infection, and mice separated into groups with homogenous symptoms and eye scores before superinfection with GD or GD-ns (Supplementary Fig.  12c, d ). Importantly, at the end of the experiment, GD and GD-ns were detected almost exclusively in the TG of mice with perfect eyes, with even low levels of scarification preventing successful superinfection (Supplementary Fig.  12e ). HSV-1 typically does not cause long-lasting scars in humans, and this residual scar tissue represented an unfortunate confounding factor in our mouse model.

To alleviate this effect, we repeated the experiment in C57Bl/6 mice (Fig.  9 ). C57Bl/6 are more resistant to HSV-1 infection and typically experience minimal symptoms. C57Bl/6 mice were infected ocularly with HSV1-WT, with 10 6 PFU in both eyes after corneal scarification. Compared to Swiss Webster and despite the higher dose, mice exhibited limited symptoms and reduced mortality during primary infection. Around 20% of mice had residual scar tissues, usually on only one eye (Supplementary Fig.  13a–d ). Four weeks later, mice were superinfected with 10 7 PFU per eye of GD or GD-ns, while being transiently immunosuppressed with dexamethasone and tacrolimus. Then, another four weeks later, mice were injected with JQ1 and Buparlisib to reactivate latent HSV-1. Buparlisib is a phosphoinositide 3-kinase inhibitor and evidence suggested that it could improve HSV-1 reactivation ( 34 , 35 and Supplementary Fig.  13e ). Reactivation rates ranged from 0 to 33% (Fig.  9a ). Most events were close to the detection limit (around 100 copies/swab) and we could successfully obtain viral genotypes from 17 out of 22 reactivation events (Fig.  9b , Supplementary Fig.  14 ). Nine out of 17 swabs (53%) were either recombinant viruses carrying mCherry and YFP , or original gene drive viruses with mCherry and CFP . In addition, two swabs were genotyped as predominantly WT (from mice #25 and #33), but had detectable amounts of mCherry , representing less than 5% of the total titer (Fig.  9b , Supplementary Fig.  14 ). In one positive swab with a low viral titer (mouse #45), both YFP and CFP markers, originating from the same US1/US2 locus, were detected, suggesting a mix of reactivated viruses. Importantly, we detected recombinants expressing YFP and mCherry in mice superinfected with either GD (1/9) or GD-ns (3/8), showing that both viruses could recombine with HSV1-WT. Because of the overall low number of reactivation events, further statistical analysis could not be conducted. In summary, we found that gene drive viruses represented more than 50% of reactivation events, with several examples of recombination with HSV1-WT.

Next, TG were dissected and latent viral loads were measured by duplex ddPCR. GD and GD-ns viruses could be detected in around 79% and 66% of TG, respectively, with more than 90% of mice having detectable GD or GD-ns in at least one TG (Fig.  9c ). GD and GD-ns titers were one to two orders of magnitude lower than WT (Fig.  9d ), and represented a small percentage of the total latent viral load, ranging from 0.5% to 50% for most samples (average at 10% and median around 1%, Fig.  9e ). We investigated whether we could detect evidence of gene drive spread in the TG. In particular, we determined whether mCherry was significantly overrepresented compared to the CFP baseline, as the gene drive cassette containing mCherry potentially recombined with HSV1-WT and increased in frequency. Of note, we observed no correlation between the viral loads in the left and right TG collected from the same animals (Pearson correlation, r 2  = 0.11), which allowed us to treat all samples as independent replicates in these analyzes (Supplementary Fig.  15a ). When plotting the titers of mCherry versus CFP , we observed that GD datapoints were significantly above the identity line ( p  < 0.0001), while GD-ns datapoints were mostly situated along the line and did not significantly deviate from it (Fig.  9f , statistical analysis in Supplementary Fig.  15b ). This suggested that the gene drive had recombined with wild-type viruses and increased in frequency in the TG of GD-superinfected mice. To quantify this enrichment, we calculated the fold change between the proportion of mCherry and CFP in the TG (Fig.  9g ). On average, in the GD-superinfected samples, we found a 70% increase in the relative proportion of mCherry compared to CFP , which was significantly higher than the control samples with GD-ns where no enrichment was observed (p = 0.0053, t-test). In the most extreme cases, the gene drive had spread more than 10-fold over the CFP baseline, for example increasing from 9% to 90% in one sample, or from 1.3% to 10% in another (Supplementary Fig.  15c ). Together, this analysis showed a limited but statistically significant spread of the gene drive in the latent wild-type population.

In summary, we found that a superinfecting gene drive virus could reach the latent reservoir and spread in the wild-type population. The immune response induced by the primary infection likely limited the spread of the second infection and the drive did not reach full penetrance. However, in both Swiss-Webster and C57Bl/6 mice, GD and GD-ns were detected in more than 50% of shedding events after JQ1 reactivation. This indicated that the superinfecting GD and GD-ns viruses could successfully reactivate and shed despite representing only a small proportion of the latent reservoir.

In this manuscript, we designed a gene drive against HSV-1 and showed that it could spread efficiently in cell culture and in vivo. In particular, we observed high levels of co-infection and gene drive-directed recombination in neuronal tissues during herpes encephalitis in mice. Furthermore, we found evidence that a superinfecting gene drive virus could recombine with HSV1-WT during latent infection. Altogether, this work presented an important proof-of-concept and showed that a gene drive could spread in vivo during acute and latent infection.

Our cell culture results recapitulated our previous work with hCMV and aligned with the findings of a recent study 11 , 28 . This showed that a gene drive could be designed in a second herpesvirus with very different infection dynamics. This suggests that viral gene drives could be developed in a wide variety of herpesviruses, which significantly expands the potential of the technology.

In co-infection experiments, both in cell culture and in vivo during acute infection, wild-type viruses expressing YFP-only were efficiently converted to recombinant gene drive viruses expressing YFP and mCherry, in a CRISPR-dependant manner. Interestingly, the proportion of original gene drive viruses expressing CFP and mCherry also increased slightly, from 20% to 40% in cell culture, and from 15% to 30% in the brain, respectively (Figs.  2 e, 3e ). This increase was observed only in experiments with GD and not in control experiments with GD-ns. Since WT, GD and GD-ns replicated with similar dynamics (Figs.  2 a, 3b ), this cannot be explained by a competitive advantage of one virus over the next. We had made a similar observation in our earlier work with hCMV 11 , suggesting that this small increase in the population of the original gene drive virus may be a constitutive feature of gene drive propagation. It may reflect complex intracellular processes occurring during viral recombination that were imperfectly captured by the three-color system used throughout our studies (Supplementary Fig.  16 ).

The spread of a viral gene drive relies on the co-infection of cells by wild-type and engineered viruses. High co-infection levels can easily be achieved in cell culture, either by using cell lines naturally susceptible to co-infection such as N2a cells, or by infecting cells at a high MOI to bypass restriction mechanisms 28 . Indirect observations in animal studies and recombination patterns in HSV strains circulating in humans indicate that co-infection events take place in vivo 15 , 16 , 17 , 18 , 19 , 20 , 21 , 22 . However, whether these co-infection events occur at a high frequency was unknown. Here, we showed that a gene drive could spread efficiently during acute infection in mice, with the level of gene drive-directed recombination increasing from 15% to 80% in some brain regions after only four days. Using fluorescent reporters, we directly observed high levels of co-infection in peripheral ganglia and the brain, with more than 50% of cells infected by two or more virions in some regions. These findings revealed that HSV-1 achieves high rates of co-infection and recombination during viral spread. Furthermore, we showed that co-infection and recombination levels varied depending on the cranial nerves used to travel to the brain. For example, co-infection and recombination were low in regions accessed by the optic nerve and much higher in regions associated with the oculomotor and trigeminal nerves (Figs.  4 – 7 ). The oculomotor and trigeminal nerves transit through the ciliary and trigeminal ganglia, respectively, and we hypothesize that these ganglia could serve as convergence zones for the virus, leading to high levels of co-infection and gene drive propagation in regions downstream of the ganglia, such as the brain stem. Conversely, the low level of gene drive recombination in the eye correlated with low levels of co-infection in the retina, and the low level of recombination in the cortex correlated with limited co-infection upstream in the viral propagation route. Propagation to the cortex originates in the retina and transits through the optic nerve and the thalamus. Co-infection was limited in the retina and the thalamus, suggesting that this route of infection may present few opportunities for co-infection and recombination. Together, this suggests that the heterogeneity in gene drive propagation reflects different levels of co-infection depending on the infection route, and that co-infection frequency is the main factor limiting gene drive spread.

Herpes encephalitis is a severe but rare condition, and HSV disease is more often characterized by chronic lesions on the facial and genital area. We showed that a gene drive virus could reach the latent reservoir and spread in a limited manner in the wild-type population (Figs.  8 and 9 ). This limited penetrance was likely caused by immune responses against HSV-1 induced by the primary infection, thus restricting the propagation of the superinfecting gene drive virus during latent infection. However, gene drive viruses represented around half of the shedding events after drug-induced reactivation, despite these viruses representing a much smaller proportion of the latent viral load. This finding has important implications. It suggests that shedding viruses originated from only a small fraction of the latent reservoir and that a superinfecting gene drive could efficiently reach the physiologically relevant neurons that seed viral reactivation. Mice do not shed HSV-1 spontaneously and our study was limited by the low reactivation rates. Further studies in animals that better recapitulate human disease, such as rabbits or guinea pigs, will be necessary to thoroughly investigate the potential of a gene drive during chronic infection.

This research represents an important milestone toward therapeutic applications. Our future work will focus on designing gene drives that can limit infectivity and reduce disease severity. Interestingly, we noticed that the titer of reactivated gene drive viruses was significantly lower than the titer of wild-type ones (Supplementary Fig.  14c ). Insertion of the gene drive sequence did not affect infectivity in cell culture or during acute infection. However, this unexpected observation suggested that the gene drive may have hampered reactivation or shedding. This could occur either directly if insertion of the gene drive had genetically impaired HSV-1, or indirectly through immune or other host-mediated effects. Similar approaches, where the gene drive virus can reach the latent reservoir efficiently but then suppress reactivation, will form the basis of future strategies. Together, our work may pave the way toward new therapeutics for HSV diseases.

As a final note, the development of gene drives in mosquitoes and other insects has generated important ecological and biosafety concerns 14 , 36 . Our approach followed the guidelines established by the NIH and the National Academy of Science 37 , 38 , 39 . In the future, the risks and benefits of viral gene drives will need to be properly addressed and discussed with the scientific community.

These studies and all procedures were approved by the Institutional Biosafety Committees and Institutional Animal Care and Use Committees of the Buck Institute and Fred Hutchinson Cancer Center. Our research followed the guidelines on gene drive research established by the NIH and the National Academy of Science 37 , 38 , 39 .

Cells and viruses

African green monkey epithelial Vero cells and murine neuroblastoma N2a cells were obtained from the ATCC and cultured in DMEM (Corning, Corning, NY, USA) supplemented with 10% FBS (Sigma-Aldrich, St-Louis, MO, USA). Viral infections and plaque assays were performed using DMEM supplemented with 2% FBS. Cells were maintained at 37 °C in a 5% CO 2 humidified incubator and frequently tested negative for mycoplasma contamination.

Unmodified HSV-1 strain 17+ and HSV1-CFP expressing cyan fluorescent protein mTurquoise2 from the US1/2 locus 15 were provided by Matthew P Taylor (Montana State University, USA). Viruses generated for this study were made by modifying HSV-1 and HSV1-CFP, as described below. To prepare viral stocks for cell culture experiments, Vero cells in 15 cm dishes were infected for one hour at MOI = 0.01, and kept in culture for 48 hours or until 100% cytopathic effect was observed. Cells and supernatant were scraped out of the plate, sonicated three times at maximum power with a probe sonicator, and debris pelleted away by centrifugation (500 ×  g rpm, 10 minutes, 4 °C). Media containing viruses was collected in single-use aliquots and titers measured by plaque assay.

For high-titer and high-purity viral stocks used for animal experiments, Vero cells in 15 cm dishes were infected for one hour at MOI = 0.01, and kept in culture for 48 hours or until 100% cytopathic effect was observed. Supernatants and cells were collected, and cells were pelleted by centrifugation (500 ×  g , 5 minutes, 4 °C). Supernatants were collected in clean tubes and reserved for later. Cell pellets were resuspended in a small volume of culture media and cell-bound virions were released by two cycles of freeze-thaw in dry ice. Debris were pelleted again and the supernatant containing released virions was combined with the supernatant reserved earlier. Virions were then pelleted by ultracentrifugation (22,000 rpm, 90 min, 4 °C, Beckman-Colter rotor SW28) on a 5-mL cushion of 30% sucrose. Supernatants were discarded, and virions were resuspended in PBS containing 2% BSA. Single-use aliquots were prepared and titers were measured by plaque assay.

Co-infection experiments were performed in 12-well plates by co-infecting N2a cells with HSV1-WT and gene drive viruses for 1 h, with a total MOI of 1, before replacing inoculum with 1 mL of fresh medium. 100uL of supernatant was collected at regular intervals and analyzed by plaque assay.

Cloning and generation of recombinant viruses

A donor plasmid containing the gene drive cassette against the HSV-1 UL37-38 intergenic region (GD and derivatives) was generated by serial modifications of the GD-mCherry donor plasmid used in our previous study 11 . All modifications were carried out by Gibson assembly (NEB, Ipswich, MA, USA), using PCR products from other plasmids or synthesized DNA fragments (GeneArt String fragments, ThermoFisher, USA). The final GD donor plasmid included homology arms for the UL37-38 region, the CBH promoter driving SpCas9 followed by the SV40 polyA terminator, the CMV promoter driving an mCherry reporter followed by the beta-globin polyA signal, and the U6 promoter controlling gRNA expression. The functional GD plasmid carried a gRNA targeting the UL37-38 region (ACGGGATGCCGGGACTTAAG), while the non-specific GD-ns control targeted a sequence absent in HSV-1 (ACATCGCGGTCGCGCGTCGG). GD-ΔCas9 donor construct was subsequently generated by removing SpCas9 by digestion and ligation. Donor constructs to insert CMV-driven yellow ( YFP ) or red ( RFP ) fluorescent protein reporters into the US1/US2 locus were built similarly, by replacing mTurquoise with mCitrine2 or mScarlet2 in a donor plasmid for the US1/US2 region, respectively (pGL002, from ref. 15 ). Of note, the YFP, CFP and RFP reporters carried a nuclear localization signal.

To build recombinant viruses, 1.5 million Vero cells were co-transfected with linearized donor plasmids and purified HSV-1 strain 17+ or HSV1-CFP viral DNA. Viral DNA was purified from infected cells by HIRT DNA extraction, as described previously 11 . Transfection was performed by Nucleofection (Lonza, Basel, Switzerland) and cells were plated in a single 6-well. After 2–4 days, mCherry-expressing viral plaques were isolated and purified by several rounds of serial dilutions and plaque purification. Purity and absence of unmodified viruses were assayed by PCR and Sanger sequencing after DNA extraction (DNeasy kit, Qiagen, Germantown, MD, USA). Viral stocks were produced as specified above and titered by plaque assay.

Plaque assay

Plaque assays were performed either directly from cell culture supernatants or from frozen mouse tissues. To release infectious virions from tissues, frozen samples were resuspended in cell culture media and disrupted using a gentle tissue homogenizer (Pellet Pestle, Fisher Scientific, USA). Samples were sonicated three times at maximum power with a probe sonicator, and debris pelleted away by centrifugation (500 ×  g , 10 minutes, 4 °C). Volumes were adjusted to a final volume of 1 mL, and titers were measured by plaque assay.

Viral titers and recombination levels were determined by plaque assay with 10-fold serial dilutions. Confluent Vero cells in 24-well plates were incubated for 1 h with 100uL of inoculum, and overlaid with 1 mL of complete media containing 1% methylcellulose, prepared using DMEM powder (ThermoFisher, USA), methylcellulose (Sigma-Aldrich, USA) and 2% FBS. After two or three days, fluorescent plaques expressing YFP, CFP and/or mCherry were manually counted using a Nikon Eclipse Ti2 inverted microscope. Every viral plaque was analyzed on YFP, CFP and red channels. 5–100 plaques were counted per well, and each data point was the average of 3–4 technical replicates (i.e., 3–4 different wells). Images of fluorescent viral plaques were acquired with an EVOS automated microscope (ThermoFisher, USA), and adjusted for contrast and exposure with ImageJ (v2.14.0/1.54 f).

The deconvolution of Sanger sequencing in Fig.  3f was performed using Synthego ICE online tools ( https://ice.synthego.com ).

gRNA design and amplicon sequencing of putative off-target sites

The gRNA targeting the HSV-1 UL37-UL38 intragenic region was designed to minimize potential off-target editing of the mouse genome, using the online design tool CRISPOR v5.2 40 ( http://crispor.gi.ucsc.edu/ ). The list of potential off-target sites, none with less than three mismatches, was downloaded and ranked according to their “Cutting Frequency Determination” (CFD) specificity score 41 . The 14 sites with CFD scores > 0.1 were analyzed by amplicon sequencing. N2a cells were infected with GD and GD-ns at MOI = 1 and cells collected after 3 days. DNA was extracted using Qiagen DNeasy kit. PCR amplicons, ranging from 180 to 300 bp for the 14 sites, were amplified using Phusion Plus high-fidelity polymerase (ThermoFisher, USA) on a Biorad Thermocycler. Amplicons were barcoded and libraries prepared using Illumina DNA Prep Kit (Illumina, USA). Barcoded amplicons were sequenced on an Illumina Nextseq 2000 using 2 × 150 read format. Demultiplexing was performed using BCLConvert (Illumina) to generate raw fastqs. Reads were trimmed and aligned on the amplicon sequences using BWA. Mutation rates at the target site were analyzed using software developed previously 42 and available on Github https://github.com/proychou/TargetedMutagenesis ). The list and location of off-target sites, PCR primers, amplicon sequences and a summary of the sequencing results are presented in Supplementary data  1 .

Mouse experiments

All animal procedures were approved by the Institutional Animal Care and Use Committee of the Buck Institute and Fred Hutchinson Cancer Center, under protocol numbers A10252 and 1865, respectively. This study was carried out in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health (“The Guide”). Standard housing, diet, bedding, enrichment, and light/dark cycles were implemented under animal biosafety level 2 (ABSL2) containment.

Acute infection after intravitreal inoculation

Acute infections were performed at the Buck Institute. Male and female Balb/c mice were purchased from Charles River Laboratories and bred in house. Between five and eight weeks-old animals were infected by intravitreal injection in the left eye, as described previously 43 , 44 . Briefly, mice were anesthetized by intraperitoneal injection of ketamine (100 mg/kg) and xylazine (10 mg/kg) and laid prone under a stereo microscope. The left eye was treated with a thin layer of veterinary ophthalmic ointment and the sclera was exposed using ophthalmic forceps. 2 μl of HSV-1 stock containing 10 6 pfu was injected slowly in the intravitreal space, using a 5uL Hamilton syringe and a 30 gauge needle. In the days following infection, mice were treated with sustained-release buprenorphine to minimize pain (Ethiqa XR, Fidelis Animal Health, North Brunswick, NJ, USA). Animals were humanely euthanized after two to four days. For plaque assay analysis, tissues were collected and snap-freezed in liquid nitrogen.

Latent infection after corneal scarification

Latent infections were performed at the Fred Hutch Cancer Center, using female Swiss-Webster or C57bl/6 mice five to six weeks old purchased from Taconic (Germantown, NY, USA). Mice were anaesthetized by intraperitoneal injection of ketamine (100 mg/kg) and xylazine (10 mg/kg) and laid under a stereo microscope. Mice corneas were lightly scarified using a 28-gauge needle, and 4uL of viral inoculum was dispensed on both eyes. Swiss-Webster and C57bl/6 mice were infected with 10 5 and 10 6 PFU, respectively. Following inoculation, ophthalmic drops of local analgesic (Diclofenac) were deposited on both eyes, and the analgesic Meloxicam was added to the drinking water ad libitum for 1-5 days following infection. From five to fifteen days following primary infection, symptoms of infection were reported and scored using an in-house scoring system. Mice experiencing severe symptoms were humanely euthanized. Once the infection had fully resolved, final eye scarification levels were scored in both eyes and averaged, using the following scores: 0: perfect eye; 1: lightly damaged and/or cloudy cornea, 2: scar tissue covering a small portion of the eye; 3: scar tissue covering most of the eye; 4: extremely bad-looking eye, fully blind.

The second infection with GD and GD-ns was performed the same way four weeks after the primary infection, with 10 7 PFU per eye. Mice were transiently immunosuppressed with dexamethasone (Fig.  8 in Swiss-Webster) or with dexamethasone and tacrolimus (Fig.  9 in C57bl/6). Tacrolimus and Dexamethasone were diluted in the drinking water and administrated ad libitum from one day before to seven days after infection. Drug concentration was calculated according to the average mice weight, considering that mice drink around 5 mL per day, in order to reach a dose of 1 mg/kg/day and 2 mg/kg/day for dexamethasone and tacrolimus, respectively. For example, for an average mouse weight of 25 g, dexamethasone and tacrolimus were diluted at 5 mg/L and 10 mg/L, respectively. Of note, drugs were diluted in medidrop sucralose (ClearH20, Westbrook, ME, USA) instead of regular drinking water, to make tacrolimus more palatable to mice.

HSV reactivation

HSV reactivation was performed by intraperitoneal injection of JQ1 (MedChemExpress HY-13030, NJ, USA) at a dose of 50 mg/kg, and, when indicated, Buparlisib (MedChemExpress HY-70063, NJ, USA) at a dose of 20 mg/kg. JQ1 and Buparlisib were prepared from stock solutions (10x at 50 mg/mL and 100x at 200 mg/mL, in DMSO, respectively) by dilution in a vehicle solution of 10% w/v 2-hydroxypropyl-β-cyclodextrin (Sigma-Aldrich, St-Louis, MO, USA) in PBS. In the C57bl/6 experiments (Fig.  9 ), mice were transiently immunosuppressed with dexamethasone and tacrolimus in the drinking water, at the concentrations indicated above, from one day before to three days after JQ1/Buparlisib injection. Mouse eyes were gently swabbed with cotton swabs moistened with PBS, on day one to three following injection. Swabs were collected into vials containing 1 ml of digestion buffer (KCL, Tris HCl pH8.0, EDTA, Igepal CA-630) and stored at 4 °C before DNA extraction.

HSV quantification of viral loads in swabs and tissues

Hsv quantification of eye swabs by qpcr.

DNA was extracted from 200 μl of swab digestion buffer using QiaAmp 96 DNA Blood Kits (Qiagen, Germantown, MD, USA) and eluted into 100 μl AE buffer (Qiagen, Germantown, MD, USA). 10 μl of eluted DNA was used to set up 30 μl real-time Taqman quantitative PCR reactions, using QuantiTect multiplex PCR mix (Qiagen, Germantown, MD, USA), using the following PCR cycling conditions: 1 cycle at 50 °C for 2 minutes, 1 cycle at 95 °C for 15 minutes, and 45 cycles of 94 °C for 1 minute and 60 °C for 1 minute. Exo internal control was spiked into each PCR reaction to monitor inhibition. A negative result was accepted only if the internal control was positive with a cycle threshold (CT) within 3 cycles of the Exo CT of no template controls. Primers and probes have been described previously 45 and are provided in Supplementary Table  1 . Swabs positive for HSV were then further analyzed by ddPCR, as described below.

Duplex digital droplet PCR (ddPCR) of tissues and swabs

Total genomic DNA was isolated from ganglionic tissues using the DNeasy Blood and tissues kit (Qiagen, Germantown, MD, USA) and eluted in 60 μl of EB buffer, per the manufacturer’s protocol.

Quantification of the YFP, CF P and mCherry markers, as well as total HSV viral load was measured with two separate duplex ddPCR, using 10uL of eluted DNA. ddPCR was performed using the QX200 Droplet Digital PCR System and ddPCR Supermix for Probes (No dUTP) from Biorad (Hercules, CA, USA), following the manufacturer’s instructions. Primers were used at a final concentration of 900 nM and probes at 250 nM (Supplementary Table  1 ). Primers and probes were ordered from IDT (Coralville, IA, USA), using IDT custom PrimeTime ZEN double-quenched qPCR probes, with FAM and HEX fluorescent dyes. The first duplex assay used two sets of primers/probes to quantify mCherry (HEX probe) and HSV UL38 gene (FAM probe). UL38 primers/probe set was located in the UL38 viral gene and recognized both wild-type and gene drive genomes. The second duplex assay distinguished between YFP and CFP , using one set of common primers amplifying both markers and YFP and CFP -specific probes with FAM and HEX dyes, respectively. Primer specificity and sensitivity were validated on plasmid DNA before use in mouse samples. A limit of detection of three copies per reaction was used throughout the study, except in Fig.  8d–f , where a cutoff of 10 was applied to mCherry to account for a small PCR contamination. Final titers were normalized and expressed in log-transformed copies per million cells (MCells). Cell numbers in tissue samples were quantified by ddPCR using a mouse-specific RPP30 primer/probe set 42 .

The duplex assays allowed us to determine the proportion of latent mCherry and CFP , using absolute values measured in the same PCR reaction, thus, limiting technical variation. Proportions were calculated as follows:

Swab genotyping

Positive swabs identified by qPCR were analyzed using the duplex ddPCR assays described above. Samples expressing YFP only with no detectable CFP and mCherry were categorized as wild-type. Swabs expressing mCherry at the same level as UL38 were categorized as gene drives. Swabs expressing both CFP and mCherry represented the original GD/GD-ns, while swabs expressing both YFP and mCherry represented recombinants (Supplementary Figs.  12 g, 14 ). Some swabs expressed mCherry one to two orders of magnitude lower than HSV and were genotyped as wild-type but with detectable amounts of mCherry . For low-titer swabs, the genotype was further confirmed by duplex qPCR using the same primers.

Brain and TG imaging and image analysis

Tissue processing and image collection.

Balb/c mice were infected ocularly with equivalent amounts of three viruses expressing either YFP, CFP or RFP from the US1-US2 locus. A total of 10 6 PFU was inoculated intravitreally in the left eye. Of note, the fluorescent proteins carry nuclear localization signals. They are expressed in infected cells and are not incorporated into virions. Four days after infection, mice were injected intraperitoneally with a terminal dose of euthanasia solution containing Sodium Pentobarbitol (Euthasol). Once unresponsive, mice were subjected to thoracotomy and transcardially perfused with PBS followed by 4% Paraformaldehyde-Lysine-Periodate solution (PLP) through the aorta to fix tissues 46 . Brains, TG, and eyes were dissected, fixed in PLP overnight, and transferred to a 20% sucrose solution for 24 hours, and finally to a 30% sucrose solution for at least 24 hours for cryo-protection. All tissues were stored in 30% sucrose before processing. This protocol was a courtesy of J.P. Card 44 .

TG and eyes were embedded in OCT and serial sections of 15 µm made using a Cryostat (Zeiss) at -20 °C. TG sections were mounted on subbing solution-treated slides and polymerizing mounting media containing DAPI (Vectashield, Vector Labs, Burlingame, CA, USA) was added before coverslipping. Brains were immobilized in 30% sucrose on a freezing microtome stage set to -18 °C (Physitemp, Clifton, NJ). Serial coronal sections at 30 µm on a horizontal sliding microtome (AO Optical) were collected. Brain sections were binned into six parallel groups. One bin was arranged and mounted on slides before counterstaining with polymerizing mounting media containing DAPI and coverslipping. Epifluorescence imaging was performed on a Nikon Ti-Eclipse (Nikon Instruments, Melville, NY, USA) inverted microscope equipped with a SpectraX LED (Lumencor, Beaverton, OR, USA) excitation module and fast-switching emission filter wheels (Prior Scientific, Rockland, MA, USA). Fluorescence imaging used paired excitation/emission filters and dichroic mirrors for DAPI, CFP, YFP and TRITC (Chroma Technology Corp., Bellow Falls, VT, USA). All images were acquired with an iXon 896 EM-CCD (Andor Technology LTD, Belfast, NI, USA) camera using NIS-Elements software. Image tiles with 4x and 10x Phase objectives were acquired to assess fluorescent protein expression across sectioned tissues. Specific regions were imaged with the 20x ELWD to acquire detailed localization and fluorescent protein expression images for subsequent data analysis.

Image analysis

From the five animals originally infected, one animal was not included as very few infected cells could be detected in the brain and TG, suggesting that the infection had failed. Furthermore, one brain and two eyes from the remaining four mice was irremediably damaged during processing. Thus, the analysis was conducted on four TG, three brains and two eyes.

Using ImageJ (v2.14.0/1.54 f), Nd2 images acquired with Nikon NIS-Element software were batch converted into tiff files using an ImageJ macro (modified from https://github.com/singingstars/ ). During the conversion process, brightfield and DAPI channels were discarded, and ImageJ background subtraction was performed on the YFP, CFP and RFP channels. An additional grayscale channel was created, composed of the maximum projection of the YFP, CFP and RFP channels. This composite channel contained every cell irrespective of the original colour and was used for segmentation (Supplementary Fig.  4a ). Machine learning-assisted segmentation was performed using an online analysis tool from www.biodock.ai (Biodock, AI Software Platform. Biodock 2023). The software was trained to recognize cells on the grey channel using a few training images, and segmentation was then run on the entire dataset. Around 3–4% of cells with aberrant area or eccentricity were discarded, and average signal intensity was measured in the original YFP, CFP and RFP channels for each detected cell. Of note, for the TG, this analysis was performed using only the YFP and CFP channels. Data was then further processed and plotted using R (RStudio v2023.09.1 + 494). For YFP and CFP, the intensity was simply log10 converted. Because RFP had a higher background and different intensity ranges across images, RFP intensity was first scaled across images, and then log10 converted. Stringent intensity thresholds were applied on the three channels and used to quantify cells infected with one, two, or three viruses, with around 5% of cells below thresholds being discarded (Supplementary Fig.  6b ). Thresholds were chosen stringently to unequivocally identify co-infected cells, and are reported in Supplementary Figs.  4c and 6c , 11e . For visualization and plotting, signal intensities in the YFP, CFP and RFP channels were converted into CYMK color space. Source data are provided in Supplementary data  2 .

Representative images shown in the manuscript were minimally adjusted for contrast and exposure using ImageJ. Some images were rotated or flipped horizontally to consistently present the brain in a caudal direction, with the left hemisphere on the right side.

Statistics and reproducibility

Experiments were carried out in multiple replicates. Investigators were blinded when performing plaque assays, collecting swabs, and analyzing DNA samples. No data was excluded, except when indicated in the main text, methods or figure legends. Statistical analyzes were performed using GraphPad Prism version 10.1.1 for macOS (GraphPad Software, USA, www.graphpad.com ). Statistical tests and their results are described in the text and figure legends. Images of co-infected tissues presented in Figs.  5 – 7 are representative images from four TG, three brains, and two eyes, respectively.

Reporting summary

Further information on research design is available in the  Nature Portfolio Reporting Summary linked to this article.

Data availability

The data supporting the findings of this study are available within the paper and its Supplementary files. Amplicon Sequencing data have been deposited in the Short Read Archive with BioProject accession no. PRJNA1128239 . Plasmids, viruses, and other reagents developed in this study are available upon request and subject to standard material transfer agreements with the Buck Institute and Fred Hutch Cancer Center.  Source data are provided with this paper.

Code availability

CRISPR off-target analysis was performed using software developed previously 42 and available on Github https://github.com/proychou/TargetedMutagenesis ).

Berrington, W. R. et al. Clinical correlates of herpes simplex virus viremia among hospitalized adults. Clin. Infect. Dis. 49 , 1295–1301 (2009).

CAS   PubMed   Google Scholar  

Brown, E. L. et al. Effect of maternal herpes simplex virus (HSV) serostatus and HSV type on risk of neonatal herpes. Acta Obstet. Gynecol. Scand. 86 , 523–529 (2007).

PubMed   Google Scholar  

Freeman, E. E. et al. Herpes simplex virus 2 infection increases HIV acquisition in men and women: systematic review and meta-analysis of longitudinal studies. AIDS 20 , 73–83 (2006).

Tanner, E. J., Kirkegaard, K. A. & Weinberger, L. S. Exploiting genetic interference for antiviral therapy. PLoS Genet 12 , e1005986 (2016).

PubMed   PubMed Central   Google Scholar  

Chaturvedi, S. et al. Identification of a therapeutic interfering particle—a single-dose SARS-CoV-2 antiviral intervention with a high barrier to resistance. Cell 184 , 6022–6036 (2021).

Dimmock, N. J., Rainsford, E. W., Scott, P. D. & Marriott, A. C. Influenza virus protecting RNA: an effective prophylactic and therapeutic antiviral. J. Virol. 82 , 8570–8578 (2008).

CAS   PubMed   PubMed Central   Google Scholar  

Mercado-López, X. et al. Highly immunostimulatory RNA derived from a Sendai virus defective viral genome. Vaccine 31 , 5713–5721 (2013).

Rezelj, V. V. et al. Defective viral genomes as therapeutic interfering particles against flavivirus infection in mammalian and mosquito hosts. Nat. Commun. 12 , 2290 (2021).

Levi, L. I. et al. Defective viral genomes from chikungunya virus are broad-spectrum antivirals and prevent virus dissemination in mosquitoes. PLoS Pathog. 17 , e1009110 (2021).

Pitchai, F. N. N. et al. Engineered deletions of HIV replicate conditionally to reduce disease in nonhuman primates. Science 385 , eadn5866 (2024).

Walter, M. & Verdin, E. Viral gene drive in herpesviruses. Nat. Commun. 11 , 4884 (2020).

Walter, M., Perrone, R. & Verdin, E. Targeting conserved sequences circumvents the evolution of resistance in a viral gene drive against human cytomegalovirus. J. Virol. 95 , e0080221 (2021).

Esvelt, K. M., Smidler, A. L., Catteruccia, F. & Church, G. M. Concerning RNA-guided gene drives for the alteration of wild populations. Elife 3 , e03401 (2014).

Bier, E. Gene drives gaining speed. Nat. Rev. Genet. 23 , 5–22 (2022).

Law, G. A., Herr, A. E., Cwick, J. P. & Taylor, M. P. A new approach to assessing HSV-1 recombination during intercellular spread. Viruses 10 , 220 (2018).

Card, J. P. et al. A dual infection pseudorabies virus conditional reporter approach to identify projections to collateralized neurons in complex neural circuits. PLoS One 6 , e21141 (2011).

Javier, R. T., Sedarati, F. & Stevens, J. G. Two avirulent herpes simplex viruses generate lethal recombinants in vivo. Science 234 , 746–748 (1986).

Nishiyama, Y., Kimura, H. & Daikoku, T. Complementary lethal invasion of the central nervous system by nonneuroinvasive herpes simplex virus types 1 and 2. J. Virol. 65 , 4520–4524 (1991).

Bowden, R., Sakaoka, H., Donnelly, P. & Ward, R. High recombination rate in herpes simplex virus type 1 natural populations suggests significant co-infection1. Infect. Genet. Evol. 4 , 115–123 (2004).

Casto, A. M. et al. Large, stable, contemporary interspecies recombination events in circulating human herpes simplex viruses. J. Infect. Dis. 221 , 1271–1279 (2020).

Koelle, D. M. et al. Worldwide circulation of HSV-2 × HSV-1 recombinant strains. Sci. Rep. 7 , 44084 (2017).

Liljeqvist, J. Å., Tunbäck, P. & Norberg, P. Asymptomatically shed recombinant herpes simplex virus type 1 strains detected in saliva. J. Gen. Virol. 90 , 559–566 (2009).

Gierasch, W. W. et al. Construction and characterization of bacterial artificial chromosomes containing HSV-1 strains 17 and KOS. J. Virol. Methods 135 , 197–206 (2006).

Taylor, M. P., Kobiler, O. & Enquist, L. W. Alphaherpesvirus axon-to-cell spread involves limited virion transmission. Proc. Natl Acad. Sci. USA 109 , 17046–17051 (2012).

Morimoto, T., Arii, J., Akashi, H. & Kawaguchi, Y. Identification of multiple sites suitable for insertion of foreign genes in herpes simplex virus genomes. Microbiol. Immunol. 53 , 155–161 (2009).

Criddle, A., Thornburg, T., Kochetkova, I., DePartee, M. & Taylor, M. P. gD-Independent superinfection exclusion of alphaherpesviruses. J. Virol. 90 , 4049–4058 (2016).

Cwick, J. P. et al. Superinfection exclusion of alphaherpesviruses interferes with virion trafficking. Microbiol Spectr. 10 , e0068422 (2022).

Yao, Q. et al. Un1Cas12f1 and Cas9 gene drive in HSV1: viruses that ‘infect’ viruses. Preprint at bioRxiv . https://doi.org/10.1101/2023.12.04.569968 (2023).

Wojaczynski, G. J., Engel, E. A., Steren, K. E., Enquist, L. W. & Patrick Card, J. The neuroinvasive profiles of H129 (herpes simplex virus type 1) recombinants with putative anterograde-only transneuronal spread properties. Brain Struct. Funct. 220 , 1395–1420 (2015).

Card, J. P. & Enquist, L. W. Transneuronal circuit analysis with pseudorabies viruses. Curr. Protoc. Neurosci. 68 , 1.5.1-39 (2014).

Google Scholar  

Banfield, B. W., Kaufman, J. D., Randall, J. A. & Pickard, G. E. Development of pseudorabies virus strains expressing red fluorescent proteins: new tools for multisynaptic labeling applications. J. Virol. 77 , 10106–10112 (2003).

Aubert, M. et al. Gene editing for latent herpes simplex virus infection reduces viral load and shedding in vivo. Nat. Commun. 15 , 4018 (2024).

Alfonso-Dunn, R. et al. Transcriptional elongation of HSV immediate early genes by the super elongation complex drives lytic infection and reactivation from latency. Cell Host Microbe 21 , 507–517.e5 (2017).

Cliffe, A. R. et al. Neuronal stress pathway mediating a histone methyl/phospho switch is required for herpes simplex virus reactivation. Cell Host Microbe 18 , 649–658 (2015).

de Gooijer, M. C. et al. Buparlisib is a brain penetrable pan-PI3K inhibitor. Sci. Rep. 8 , 10784 (2018).

Brossard, D., Belluck, P., Gould, F. & Wirz, C. D. Promises and perils of gene drives: navigating the communication of complex, post-normal science. Proc. Natl Acad. Sci. USA 116 , 7692–7697 (2019).

Emerson, C., James, S., Littler, K. & Randazzo, F. Principles for gene drive research. Science 358 , 1135–1136 (2017).

National Academies of Sciences, E. A. M. Gene Drives on the Horizon . (National Academies Press, Washington, D.C., 2016).

NOT-OD-24-093: Notice of revisions to the NIH guidelines for research involving recombinant or synthetic nucleic acid molecules. https://grants.nih.gov/grants/guide/notice-files/NOT-OD-24-093.html .

Concordet, J.-P. & Haeussler, M. CRISPOR: intuitive guide selection for CRISPR/Cas9 genome editing experiments and screens. Nucleic Acids Res. 46 , W242–W245 (2018).

Doench, J. G. et al. Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Nat. Biotechnol. 34 , 184–191 (2016).

Aubert, M. et al. Gene editing and elimination of latent herpes simplex virus in vivo. Nat. Commun. 11 , 4148 (2020).

Card, J. P., Whealy, M. E., Robbins, A. K., Moore, R. Y. & Enquist, L. W. Two alpha-herpesvirus strains are transported differentially in the rodent visual system. Neuron 6 , 957–969 (1991).

Card, J. P. & Enquist, L. W. Use and visualization of neuroanatomical viral transneuronal tracers. in Visualization Techniques 225–268 (Humana Press, Totowa, NJ, 2012).

Jerome, K. R., Huang, M.-L., Wald, A., Selke, S. & Corey, L. Quantitative stability of DNA after extended storage of clinical specimens as determined by real-time PCR. J. Clin. Microbiol. 40 , 2609–2611 (2002).

McLean, I. W. & Nakane, P. K. Periodate-lysine-paraformaldehyde fixative. a new fixation for immunoelectron microscopy. J. Histochem. Cytochem. 22 , 1077–1083 (1974).

Download references

Acknowledgements

We thank ophthalmologist Koji Kitazawa (Buck Institute and Kyoto Prefectural University of Medicine) for training MW with intravitreal injections. We thank members of the Verdin and Jerome labs for technical and conceptual help. This study was supported by NIH grant R21AI178255 and through institutional support from the Buck Institute for Research on Aging and the Fred Hutch Cancer Center. In particular, MW received funding from the VIDD faculty initiative award from the Fred Hutch Cancer Center.

Author information

Authors and affiliations.

Vaccine and Infectious Disease Division, Fred Hutch Cancer Center, Seattle, WA, US

Marius Walter, Anoria K. Haick, Paola A. Massa, Lindsay M. Klouser, Michelle A. Loprieno, Pavitra Roychoudhury, Martine Aubert & Keith R. Jerome

Buck Institute for Research on Aging, Novato, CA, US

Marius Walter, Rebeccah Riley & Eric Verdin

Department of Laboratory Medicine and Pathology, University of Washington, Seattle, WA, US

Daniel E. Strongin, Laurence Stensland, Tracy K. Santo, Pavitra Roychoudhury & Keith R. Jerome

Department of Microbiology & Cell Biology, Montana State University, Bozeman, MT, US

Matthew P. Taylor

You can also search for this author in PubMed   Google Scholar

Contributions

M.W. designed the study with input from E.V., K.R.J., and M.P.T. M.W. performed all cell culture experiments. M.W. and R.R. wrote the IACUC protocol at the Buck Institute. M.W., R.R., A.K.H., P.A.M., M.A.L., D.E.S., and M.A. contributed to mouse husbandry and mouse experiments. L.M.K., L.S., and T.K.S. processed samples at the University of Washington Virology Laboratory. M.W. and M.P.T. performed the analysis of co-infection in the brain. P.R. contributed to the off-target analysis. M.W., M.P.T., K.R.J., and E.V. analyzed the data. M.W. wrote the manuscript with input from all authors. M.W., E.V., and K.R.J. supervised and funded the project.

Corresponding authors

Correspondence to Marius Walter , Keith R. Jerome or Eric Verdin .

Ethics declarations

Competing interests.

A patent application describing the use of a gene drive in DNA viruses has been filed by the Buck Institute for Research on Aging (Application number 17054760, inventor: M.W.). The authors declare no further competing interests.

Peer review

Peer review information.

Nature Communications thanks Rongtuan Lin and the other anonymous reviewer(s) for their contribution to the peer review of this work. A peer review file is available.

Additional information

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary information, peer review file, description of additional supplementary files, supplementary data 1, supplementary data 2, reporting summary, source data, rights and permissions.

Open Access This article is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License, which permits any non-commercial use, sharing, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if you modified the licensed material. You do not have permission under this licence to share adapted material derived from this article or parts of it. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by-nc-nd/4.0/ .

Reprints and permissions

About this article

Cite this article.

Walter, M., Haick, A.K., Riley, R. et al. Viral gene drive spread during herpes simplex virus 1 infection in mice. Nat Commun 15 , 8161 (2024). https://doi.org/10.1038/s41467-024-52395-2

Download citation

Received : 05 March 2024

Accepted : 05 September 2024

Published : 17 September 2024

DOI : https://doi.org/10.1038/s41467-024-52395-2

Share this article

Anyone you share the following link with will be able to read this content:

Sorry, a shareable link is not currently available for this article.

Provided by the Springer Nature SharedIt content-sharing initiative

By submitting a comment you agree to abide by our Terms and Community Guidelines . If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Quick links

• Explore articles by subject
• Guide to authors
• Editorial policies

Sign up for the Nature Briefing newsletter — what matters in science, free to your inbox daily.

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings
• My Bibliography
• Collections
• Citation manager

Save citation to file

Email citation, add to collections.

• Create a new collection
• Add to an existing collection

Add to My Bibliography

Your saved search, create a file for external citation management software, your rss feed.

• Search in PubMed
• Search in NLM Catalog
• Add to Search

A drug repurposing screen identifies decitabine as an HSV-1 antiviral

Affiliations.

• 1 The Department of Molecular Biology and Biochemistry, The University of California Irvine, Irvine, California, USA.
• 2 Pritzker School of Molecular Engineering, The University of Chicago, Chicago, Illinois, USA.
• 3 The Department of Microbiology and Molecular Genetics, The University of California Irvine, Irvine, California, USA.
• 4 The Center for Virus Research, The University of California Irvine, Irvine, California, USA.
• 5 The Center for Complex Biological Systems, The University of California Irvine, Irvine, California, USA.
• PMID: 39287456
• DOI: 10.1128/spectrum.01754-24

Herpes simplex virus type 1 (HSV-1) is a highly prevalent human pathogen that causes a range of clinical manifestations, including oral and genital herpes, keratitis, encephalitis, and disseminated neonatal disease. Despite its significant health and economic burden, there is currently only a handful of approved antiviral drugs to treat HSV-1 infection. Acyclovir and its analogs are the first-line treatment, but resistance often arises during prolonged treatment periods, such as in immunocompromised patients. Therefore, there is a critical need to identify novel antiviral agents against HSV-1. Here, we performed a drug repurposing screen, testing the ability of 1,900 safe-in-human drugs to inhibit HSV-1 infection in vitro . The screen identified decitabine, a cytidine analog that is used to treat myelodysplastic syndromes and acute myeloid leukemia, as a potent anti-HSV-1 agent. We show that decitabine is effective in inhibiting HSV-1 infection in multiple cell types, including human keratinocytes, that it synergizes with acyclovir, and acyclovir-resistant HSV-1 is still sensitive to decitabine. We further show that decitabine causes G > C and C > G transversions across the viral genome, suggesting it exerts its antiviral activity by lethal mutagenesis, although a role for decitabine's known targets, DNA methyl-transferases, has not been ruled out.

Importance: Herpes simplex virus type 1 (HSV-1) is a prevalent human pathogen with a limited arsenal of antiviral agents, resistance to which can often develop during prolonged treatment, such as in the case of immunocompromised individuals. Development of novel antiviral agents is a costly and prolonged process, making new antivirals few and far between. Here, we employed an approach called drug repurposing to investigate the potential anti-HSV-1 activity of drugs that are known to be safe in humans, shortening the process of drug development considerably. We identified a nucleoside analog named decitabine as a potent anti-HSV-1 agent in cell culture and investigated its mechanism of action. Decitabine synergizes with the current anti herpetic acyclovir and increases the rate of mutations in the viral genome. Thus, decitabine is an attractive candidate for future studies in animal models to inform its possible application as a novel HSV-1 therapy.

Keywords: antiviral agents; decitabine; herpes simplex virus; lethal mutagenesis.

PubMed Disclaimer

LinkOut - more resources

Full text sources.

• Citation Manager

NCBI Literature Resources

MeSH PMC Bookshelf Disclaimer

The PubMed wordmark and PubMed logo are registered trademarks of the U.S. Department of Health and Human Services (HHS). Unauthorized use of these marks is strictly prohibited.

An official website of the United States government

The .gov means it’s official. Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

The site is secure. The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

• Publications
• Account settings

The PMC website is updating on October 15, 2024. Learn More or Try it out now .

• Advanced Search
• Journal List
• Vaccines (Basel)

Insights into the Novel Therapeutics and Vaccines against Herpes Simplex Virus

Shiza malik.

1 Bridging Health Foundation, Rawalpindi 46000, Pakistan

2 Department of Microbiology, Institute of Medicine, Tribhuvan University Teaching Hospital, Kathmandu 44600, Nepal

3 Department of Microbiology, Dr. D. Y. Patil Medical College, Hospital and Research Center, Dr. D. Y. Patil Vidyapeeth, Pune 411018, Maharashtra, India

4 Department of Medicine, School of Health Sciences, Foundation University Islamabad, DHA Phase I, Islamabad 44000, Pakistan

Khalid Muhammad

5 Department of Biology, College of Science, UAE University, Al Ain 15551, United Arab Emirates

Yasir Waheed

6 Office of Research, Innovation, and Commercialization (ORIC), Shaheed Zulfiqar Ali Bhutto Medical University, Islamabad 44000, Pakistan

7 Gilbert and Rose-Marie Chagoury School of Medicine, Lebanese American University, Byblos 1401, Lebanon

Associated Data

Not applicable.

Herpes simplex virus (HSV) is a great concern of the global health community due to its linked infection of inconspicuous nature and resultant serious medical consequences. Seropositive patients may develop ocular disease or genital herpes as characteristic infectious outcomes. Moreover, the infectious nature of HSV is so complex that the available therapeutic options have been modified in certain ways to cure it. However, no permanent and highly effective cure has been discovered. This review generates insights into the available prophylactic and therapeutic interventions against HSV. A methodological research approach is used for study design and data complication. Only the latest data from publications are acquired to shed light on updated therapeutic approaches. These studies indicate that the current antiviral therapeutics can suppress the symptoms and control viral transmission up to a certain level, but cannot eradicate the natural HSV infection and latency outcomes. Most trials that have entered the clinical phase are made part of this review to understand what is new within the field. Some vaccination approaches are also discussed. Moreover, some novel therapeutic options that are currently in research annals are given due consideration for future development. The data can enable the scientific community to direct their efforts to fill the gaps that remain unfilled in terms of therapies for HSV. The need is to integrate scientific efforts to produce a proper cure against HSV to control the virus spread, resistance, and mutation in future disease management.

1. Introduction

Herpes simplex virus (HSV) belongs to the family of Alphaherpesvirinae with a characteristic double-stranded DNA structural composition [ 1 ]. Its two main serotypes, HSV-1 and HSV-2, are mainly known for their links with infectious diseases [ 2 ]. According to estimates by WHO, approximately 70–90% of the population worldwide is seropositive for HSV-2, which makes it a great concern for the healthcare community regarding the possibility of developing infections (James & Kimberlin, 2015b) [ 3 ]. HSV-1 is considered the main causative agent of ocular infection that may occur in patients already having diseases such as genital lesions, keratitis or retinal necrosis, encephalitis, iridocyclitis, or conjunctivitis [ 4 , 5 , 6 ]. Some studies have also established links between longstanding HSV-1 serology with psychological complications, including Alzheimer’s disease [ 7 ]. On the other hand, HSV-2 is predominantly linked with characteristic genital herpes disease of the herpes virus. These infections are worldwide, irrespective of the developing or industrialized national standing [ 8 ].

HSV-2 virus is a sexually transmitted infectious agent that is prevalent in approximately 536 million people worldwide, standing at an annual incidence rate of about 23.6 million cases, as per the updates by the CDC [ 9 , 10 ]. The genital area is the prime target of viral infection; however, it may also cause infections similar to HSV-1, including necrotizing stromal keratitis in the eyes, meningitis, encephalitis, and neurological complications [ 11 ]. However, not all HSV-2-positive cases develop genital herpes or ulcerative and vesicular lesions because the virus mostly remains in a latency phase that makes it possible to transmit to other members of the populace without getting noticed and without exhibiting any infectious outcomes [ 12 ]. In simple words, the sexual transmission may not be coupled with a clinical history or symptomatology of genital herpes. The symptomology makes the viral presence rarely fatal, but the same is not the case for babies from infected mothers and pregnant ladies, due to their immunocompromised system and susceptibility to easily acquire infection [ 12 , 13 , 14 ].

The most prevalent feature that makes HSV infection complications is its ability to enter a nonreplicating latency period, which enables it to survive long periods of inactivation within the host and gives it the ability to reactivate and infect the host under different external and internal stimuli [ 12 , 13 ]. The latency period is mostly asymptomatic; thus, viral transmission during this period remains unrecognized. This aspect is considered the major reason for the large-scale seroprevalence of HSV [ 13 ]. Additionally, it can infect almost every type of cell for the characteristic receptor recognition strategies, making it pertinent to large-scale population spread [ 10 ]. This property is associated with the presence of hundreds of diverse glycoproteins in HSV lipid bilayers that alter its receptor recognition and viral entry into host cells [ 8 , 15 , 16 , 17 , 18 , 19 ]. Furthermore, it uses multiple strategies for viral fusion, endocytosis, and transmission among cells, all of which cause further complications its treatment procedures [ 20 , 21 ]. Thus, most of the therapeutic studies are limited in terms of their effectiveness and inability to eradicate infections.

The complex nature of the virus, in terms of symptomatic infections and asymptomatic presence and recurrence, makes its cure difficult; for this reason, no vaccination or therapeutic cure has been devised that could completely eradicate HSV infection [ 21 , 22 ]. Moreover, the lifelong presence of HSV-2 infection further complicates the treatment procedures because it may require prolonged administration of standard proposed treatments, which is in line with its resistive nature [ 12 , 23 ]. In this review, we discuss the primary nature of HSV that makes it complicated for the design of therapeutics. This understanding can set the pace for further insight into the therapeutic interventions designed to date [ 24 ]. We discuss how the antiviral strategies are designed knowing the complexities associated with viral entry, infection, and persistence. The focus is on therapeutic developments that may hold hope for future control over HSV infections.

2. Materials and Methods

A systematic approach was used to gather the latest data regarding the different dimensions of H. simplex virus infection and the accumulated therapeutic and vaccination strategies. We searched electronic sources such as Google Scholar, Pub Med, NIH (National Library of Medicine), Scopus (Elsevier), and Web of Science. Moreover, the official websites of WHO, CDC, UNAID, and FDA were also used to obtain the statistical results and latest updates regarding HSV epidemiology, as well as ongoing treatment efforts. As the studies mainly incorporated the data regarding therapeutics against HSV viruses, the major research terms were “Herpes simplex virus”, “HSV infection”, “therapeutics against HSV”, “antiviral agents”, “vaccines against HSV”, “therapies against HSV”, “novel therapeutic approaches”, and some other linked search terms. After a thorough analysis of the dates, abstracts, titles, and journals of research publications, they were made part of this review. The process of information gathering was not limited to a few studies but rather collected from research compilations in the form of original research articles, reviews, short commentaries, case reports, and letters to the editors. Lastly, the search strategy was limited to incorporating data from 2010 to 2022 to add only the most recent advances related to HSV disease management.

3. Results and Discussion

3.1. the pathological biology of hsv and associated infection.

As explained earlier, HSV belongs to the family of neurotropic alpha herpesviruses, which are well known for latency features [ 4 , 12 ]. The virus particle consists of an internal dense electron core that contains the reproductive material in the form of double-stranded DNA [ 25 ]. All age groups of people are prone to developing HSV infection. Some other pathogenic species of viruses belonging to the same DNA herpes family of viruses include varicella-zoster virus (VZV), Epstein–Barr virus (EBV), cytomegalovirus, and human herpes types 6, 7, and 8 [ 26 ]. The two subtypes of HSV-1 and HSV-2 share close genomic relevance with >80% of the amino-acid identity profile. Moreover, both share the common infectious nature of causing oral and genital ulcerations [ 26 , 27 ].

HSV DNA has been well studied and formulated to encode 70+ genes. The genomic portion is enveloped by a viral capsid of icosahedral shape that in turn displays >162 known protein units (capsomers) [ 28 , 29 ]. The virus capsid is further surrounded by a lipid bilayer envelope consisting of tegument proteins and several dozen glycoproteins on the surface. Of this GP, five glycoproteins with known functions are gB, gC, gD, gH, and gl [ 30 ]. These proteins facilitate host viral coordination in terms of attachment, binding, and host cell penetration and entry [ 31 , 32 ]. The complex mechanism of HSV host interaction and its latency period present scientists with a great challenge [ 33 ]. The host virus entry mechanisms, cellular interaction, and infectious cycles are, thus, the prime focus of understanding for scientists developing therapeutics. This is discussed in relevance to HSV therapeutics in a later section of this article to describe to the readers the procedures, limitations, and progress achieved in this domain [ 27 , 34 ].

The virus Infection mainly begins with the epithelial cells of the skin or mucosal surfaces. The virus particle then trickles down to nerve endings and nerve axons, where the virus undergoes persistent infection within the trigeminal or lumbosacral ganglia region [ 12 , 35 ]. After establishing virus progeny in this area, it returns to the mucosal and skin surfaces to produce oral or genital ulcers. At other times, it remains asymptomatic, associated with viral shedding and silent transmission to other hosts [ 36 , 37 ]. This asymptomatic and silent transmission nature makes HSV spread quite extensively unnoticed in the population, as most cases remain subclinical and, thus, hidden from diagnosis [ 1 , 21 ]. The clinical manifestations of HSV-1 and HSV-2 vary depending on the age group, entry route, host immune response, and initial or recurrent nature of the infection [ 1 ].

HSV-1 is linked with episodes of genital and neonatal herpes, in addition to mainly causing oral and facial infections [ 38 ]. The disease incidences are higher in HICs, though the disease occurrence rates in neonates are lower compared to the incidence in children in LICs, where ≥90% people acquire HSV-1 infection by adolescence, which makes it a great healthcare burden for the world [ 10 ]. The major disease outcomes of HSV-1 infection include herpes labialis, gingivostomatitis, HSV-linked infectious encephalitis, keratitis, and pharyngitis [ 39 ]

HSV-2, on the other hand, is mainly dependent on sexual transmission and is associated with genital ulceration (genital ulcer disease (GUD)). Apart from the risk of neonatal herpes and possibly being associated with the development of neurological disorders such as Alzheimer’s at a later age, an increased risk of developing HIV infection is linked to HSV-2 infection [ 1 , 12 , 14 ]. The disease incidence is continuously rising on an annual basis due to the silent nature among sexual partners with high HSV-2 seroprevalence [ 3 , 13 ]. Additionally, the incidence rates are mostly outlined for high-income countries where R&D is progressively outlined in databases, while, in the case of low-income countries, the incidence rates are still unknown [ 10 ]. Neonatal herpes infections are often the major causes of increased morbidity and mortality rates. Most importantly, HSV-2 infection and transmission are linked with up to threefold increased incidence of HIV epidemics, with incidence rates up to 23–50% being the major concern regarding healthcare management. Moreover, the clinical complications in terms of life-threatening incidences may be accounted for in immunocompromised individuals [ 40 ].

The major diagnostic tests performed for HSV detection mainly include polymerase chain reaction, type-specific serological essays, viral culture, and antigen detection assays, which differentiate between the two subtypes of HSV [ 21 , 41 ]. The main treatment strategies against genital herpes mainly include antiviral treatments, such as acyclovir, valacyclovir, or famciclovir among other antiviral agents mentioned by WHO guidelines [ 3 , 9 , 22 ]. Most of these treatment regimens require continuous application to reduce the symptoms without permanently dealing with the virus prevalence. In the upcoming sections, we discuss the various therapeutic strategies and vaccination efforts against HSV carried out recently, as well as outline the futuristic perspective for HSV treatment.

3.2. Current Vaccination Efforts against HSV

Currently, no vaccine has been specified against HSV infection; however, several vaccination candidates are in research annals for vaccine development. Most of the clinical efforts are directed toward HSV-2 for its greater infectious outcomes, but HSV-2 vaccines will have benefits against both subtypes of viruses because of their sequence homology [ 42 , 43 , 44 ]. Several lines of research show that HSV vaccination is feasible. Successful vaccination strategies against varicella-zoster virus by using replated herpes virus biology, bovine herpesvirus-1, and herpesvirus-1 (pseudorabies virus) indicate that effective vaccine efforts against HSV can be successful [ 44 ]. Similarly, work on vaccines along with antiviral adjuvants has also presented preventive abilities against herpes zoster infection, with proven 97% efficacy in phase III trials [ 43 , 44 , 45 ].

Studies on human papillomavirus vaccination protocols are also helping with the understanding of immunomodulatory regulation which can be effectively induced with vaccination against HSV [ 43 , 46 ]. Some other research groups tested herpes vaccine trials with truncated glycoprotein D2 (Gd2T) vaccines tested on thousands of HSV-positive cases and demonstrated vaccine efficacy of up to 58% against HSV-1 with little or no effect against HSV-2. These studies indicated that immunomodulation against HSV-1 can be achieved with antibody titers, but the same cannot yet be shown for HSV-2 [ 21 , 30 ]. Additionally, the viral sequencing, widescale data availability, and genetic profiling for both HSV-1 and HSV-2 predict that better vaccination protocols could be implemented with the identification of potential targets for therapeutic development. With proper and coordinated efforts among bioinformaticians and clinicians, these efforts could be successful [ 46 , 47 ].

The rigorous efforts put forward for vaccination development come in two major forms, preventive and therapeutic vaccination protocols [ 48 ]. The former provides pre-exposure immune-protective responses against HSV-2 infection development tested over the long term up to phase III trials [ 43 ]. These trials have mostly been limited to HIC. It is hypothesized that the same preventive vaccination practices in LMIC could produce better results in terms of disease mitigation and adaptive management. For this cause, the geographic strain diversity must be accounted for during vaccination development to ensure the nonrestrictive geographic nature of HSV vaccination. Scientists propose that, if any candidate vaccine was found to be effective for both HSV subtypes, it could be shifted from adolescents to infants for the possible prevention option [ 14 , 49 ].

Therapeutic vaccines, in contrast, are being tested to reduce the disease symptoms and viral transmission across the hosts, for the larger benefit of public health management. For this route, the targeted populace is mostly HSV-2-infected persons. Some therapeutic candidates have been checked up to phase I and II trials with proven antiviral effects, as well as decreased viral shedding and lesion formation in infected subjects [ 30 , 48 ]. Similar to the first line of preventive vaccinations, this route has also been tested mostly in HIC without solid testing in LMICs [ 20 ]; a limitation to these preclinical trials on animals is that they cannot be assumed to be effective in humans since the host viral interaction could be different in people. Thus, certain limitations are attached to phase I and II trials. Therefore, some effort should be put into clinical experimentation for rapid disease management in the future [ 47 ].

3.3. Outlining the Current Vaccines against HSV

Various vaccine candidates are in research annals for preclinical and clinical evaluation. Currently, there is no specific FDA-approved vaccine against HSV infection [ 9 ]. The ongoing clinical and preclinical trials are based on the rational understanding of HSV biology and immunopathogenesis in host cells. Some of the latest vaccine designs, their working mechanism, and ongoing trials are outlined briefly in the Table 1 .

An update on current vaccine candidates against HSV.

3.3.1. Subunit Vaccines against HSV

Subunit vaccines are composed of viral components, such as glycoproteins and protein subunits, which undergo protective immune responses to the host [ 50 ]. They have proven safer, stable, and effective for HPV vaccination design and immunization design, but still lack clinical experimental success against HSV [ 51 ]. They mostly use viral glycoproteins and antigenic mediators such as Gb/Gd/gE in their antiviral design. This type of vaccine varies in function and procures the inhibition of viral entry, viral shedding, transmission across cells, and immune-evasive responses [ 42 , 50 , 51 ]. Novel experiments are ongoing that link multiple herpes antigens and peptide epitopes in one vaccination protocol. Approximately 80–300 open readings frames (ORFs) identified by multi-omics technologies are under consideration for antigenic breadth generation and efficiency in subunit vaccines against HSV [ 42 , 52 , 53 ].

This method of vaccination provides a gateway to present complex antigenic composition to the immune system that may include T- and B-cell epitopes [ 22 , 72 ]. For testing the efficacy of these vaccines, several recombinant protein formats have been tested that are conceptually similar and undergo the introduction of HSV ORFs (complete or near complete), into bacterial or other vector systems [ 54 , 73 ]. Moreover, these vaccine combinations with certain adjuvants and vaccine formats have opened a new route to explore options for HSV vaccination in the future.

3.3.2. Vectored/DNA/RNA Vaccines against HSV

DNA- and mRNA-based vaccines have been in research annals for a long time now. The same approach has been successfully used in COVID vaccination design and is now being successfully utilized against HSV [ 74 , 75 ]. Experiments have been conducted on animal models to check the efficacy of nucleoside-modified mRNA-based vaccines against HSV-2 infection [ 75 ]. The results indicated a therapeutic reduction in symptoms within animal models in a dose-dependent manner. Moreover, these vaccines stimulate immune responses in the form of neutralizing antibodies [ 76 ]. Studies have shown that DNA is a better candidate for its stability, synthesis characteristics, and purification protocol and can be better managed compared to mRNA [ 29 , 62 ].

DNA-based vector vaccines have shown efficacy even better than subunit vaccines but not as effective as live-attenuated vaccines [ 29 , 62 ]. Moreover, some clinical concerns in the form of side-effects remain linked to the application of vehicle vector carriers [ 77 ]. Thus, adenovirus vector-based vaccines exhibit a better stability profile than mRNA vaccines. Recent studies showed the use of Vaccinia and MVA vectors for the deployment of transgenetic expression and virulence in tested subjects against different viral diseases caused by HIV, influenza, measles, flavivirus, and malaria vectors [ 11 , 45 ]. Thus, these insights into vaccination approaches compel scientists to drain effective vaccination efforts against HSV [ 78 ].

3.3.3. Live-Attenuated Vaccines against HSV

The live-attenuated vaccination method has been the most used and effective method against viral infections through history, such as smallpox vaccination, poliomyelitis, measles, mumps, rubella virus, rotavirus, and many other infections [ 63 ]. The mechanism of inactivation often includes chemical or radiation-based inactivation of virus particles. One of the antiviral vaccine candidates derived for chicken pox virus/HSV-3 (varicella-zoster virus (VZV)) is also based on a live-attenuated virus vaccination protocol [ 62 ]. It is safe and well tolerated with a highly effective profile that controls viral reactivation. This and several other examples guide a more effective vaccination protocol to be designed on the basis of this mechanism [ 43 , 62 , 63 , 64 ].

Live-attenuated vaccination has also contributed to the development of FDA-approved oncolytic virotherapy against herpes simplex virus known as (TVEC or Imlygic), which limits virus replication and regulates human immunity, and which is used for treating human melanoma [ 63 ]. Following this approach, novel vaccination drives are being tailored in medical science to reduce the side-effects and induce long-term immunity against HSV infection, with the aim of achieving prophylactic and therapeutic goals to reduce viral infection and reduce the disease symptomology [ 43 , 62 ]. Moreover, efforts are being directed to reducing the neurotropism and latency associated with HSV while designing the live-attenuated vaccination regimens. Thus, by introducing certain insertions and/or or deletions in the viral progeny, the vaccination attempts show disrupting neuronal retrograde transport and the respective inability of HSV to affect neuronal cells [ 32 , 38 , 65 ]. Some important clinical ongoing trials in this regard are provided in Table 1 .

3.3.4. Peptide Vaccines against HSV

Peptide vaccines are developed on the principle that a single molecular entity or peptide epitope could generate massive immune responses to protect against a particular disease. In this regard, immunization with immuno-dominant T-cell epitopes or neutralizing epitopes has been tested and found to be protective [ 58 ]. This system of vaccination has shown better outcomes upon the combined application of certain adjuvants such as heat-shock proteins that may be expressed in recombinant viruses or bacterial expression systems [ 37 ]. However, the complications and limitations associated with the widespread human population and differential immune responses that may entail immunodominant responses by a certain peptide hinder the development of peptide-based vaccines [ 25 , 31 ]. However, efforts are still in research annals to develop better vaccination options for both serotypes of HSV.

3.3.5. Killed-Virus Vaccines against HSV

Similar to the live-attenuated mechanism, this mechanism involves variations in terms of killed virus vaccination to avoid the risk of reactivation of viruses in subjects. Traditionally, phenol chemicals and UV light treatments have been used for this purpose, but other methods of viral inactivation have also been used more recently [ 79 , 80 ]. This approach is used as immunotherapy but remains underrated as it only provides little help to regress the viral infection, which is a property of natural infection. Recent advances have been made, and some newer studies are in progress that use sonication, chemicals, radiation, UV light, formaldehyde treatment, or their combination to cause viral death [ 80 , 81 , 82 ]. Moreover, experiments are performed by regulating the dosage amount, time, route, and number of administrations and combination with adjuvants to check the efficacy. However, further work is necessary to deduce the efficiency of this vaccination method [ 80 , 83 ].

3.3.6. Fractionated-Virus Vaccines against HSV

In these protocols, HSV vaccines are prepared by subjecting the infected cultured cells to various procedures, which inactivate the virus particles while partially purifying some viral protein subsets [ 82 , 84 ]. Trials are ongoing on such vaccination methods. In simple terms, viral characteristic proteins such as those used in peptide vaccines (e.g., gPs) are mixed with inactive virus particles and with some adjuvants to produce a binding effect of the vaccine. Previous studies have shown little or no effect on immune responses; thus, this approach requires further work to induce productive clinical outcomes [ 30 , 31 ].

3.3.7. Discontinuously Replicating Virus Vaccines against HSVs

In this method, some important genes required for viral replication or transmission are either deleted or replaced with other genes. The method is mainly used to study the functionalities of different proteins; however, the same approach is often used for designing vaccines [ 22 , 73 ]. These viruses may undergo replication but are unable to further infect the cell because they are transmission noncompetent. Because of this effect, they are termed as discontinuously replicating viruses. They exhibit the property of inability to restimulate periodically to have a recurrent, peripheral lytic replication cycle [ 47 , 64 ]. They have been checked in animal subjects for creating strong immune responses, with some candidates entering clinical trials, as indicated in Table 1 . However, further work is required for effective clinical improvement in vaccination implications.

3.3.8. Replication-Competent Live-Virus Vaccines against HSV

As the name indicates, these vaccines exhibit the replication property of viruses but undergo certain insertions and or deletion of encoded genes for application. They generate broad-scale immunostimulatory effects, including reactions from T and B cells and neutralizing antibodies. [ 85 ] They undergo the presentation of a complex mixture of epitopes with only a few missing genes. In the case of latency and reactivation from virus progeny, an endogenous re-boosting effect is created [ 12 ]. However, the limitation is that the possibility of mutation and reactivity with the wildtype strain of HSV in an immunocompromised individual may alter the vaccine mechanism. Moreover, complications may also be faced in terms of viral strain production and serological testing of HSV infection [ 12 , 13 ]. Several genetic studies have been conducted to understand which genes can be deleted for the preparation of replication-competent vaccines. This method is similar or identical to the method used in live-attenuated vaccination [ 61 , 63 ].

3.4. Therapeutics and Antiviral Strategies against HSV

When HSV infection was initially identified as a health concern, several therapeutic trials were put into research trials for evaluating different drugs against it. So much research was conducted around the time of the discovery of acyclovir back in the 1980s [ 21 ]. The search has not stopped even now, and new therapeutics are being developed that focus on different mechanisms of antiviral action [ 86 , 87 , 88 ]. This may include various approaches such as virus entry inhibitors, fusion, or virus-release inhibitors. Among these trials, N-docosanol (an entry inhibitor) is the only FDA-approved drug that is used to counter herpes labialis but not recurrent genital herpes or ocular infection [ 48 ]. More effective therapies are required to contain the global burden associated with HSV infections. Some of the major drugs with varying mechanisms of action are briefly described in the next section and a summary has been presented in form of Table 2 at the end of this section.

3.4.1. Receptor Targeting Therapeutics against HSV

These therapeutics work by preventing the receptor virus binding phenomena by targeting HSV entry molecules/receptors or glycoproteins on the host cell surface. They demonstrate both prophylactic and therapeutic efficiencies against HSV [ 38 , 47 , 89 ].

Anti-Heparan Sulfate Peptides

Two important receptor peptides, G1 and G2, have a role in binding to the cell surface receptors of HS (present in almost all cell types) and targeting them to block HSV-1 infection [ 55 ]. This phenomenon has been dose-dependently checked in cell line-based experiments. These results indicate the potential benefit of the inhibition of viral replication and cell-to-cell viral spread [ 56 ]. Similarly, experiments on animal models exhibited their prophylactic properties against ocular and genital infections. The overall number of genital lesions was reduced in tested subjects. However, a limitation of these drugs is the presence of HS receptors on all cells; thus, the drugs may produce side-effects in healthy cells, while there is a need to prevent the associated cytotoxicity [ 11 , 55 , 56 ].

Apolipoprotein E

Apolipoprotein E (apoE) is a glycoprotein that helps in viral attachment and entry by binding directly to heparin sulfate proteoglycans in the extracellular matrix of the host cell membrane [ 90 ]. Specifically, the tandem repeat dimer peptide, apoEdp, exhibits antiviral activity against both HSV 1 and HSV 2, as well as HIV. The effective results of these drugs have been shown to induce corneal infection along with immunomodulation in terms of downregulated proinflammatory and angiogenic cytokines [ 40 , 90 ]. Moreover, the drugs exhibited low or no systematic toxicity in mouse models. Their effect has been comparatively evaluated to be the same as that of the currently in-use drug trifluoro thymidine (TFT) against HSV-1. The therapeutic effects have largely been shown to reduce infection symptomology in animal models [ 40 , 90 ].

AC-8-Potential Cationic Peptide

AC-8 is an igG FAB fragment that exhibits antiviral properties by binding to the glycoprotein D receptor [ 57 ]. This drug has shown efficacy in terms of reducing corneal vascularization and keratitis in mouse models. This property is produced due to the essential role of Gd in the herpes virus entry mechanism, which AC-8 successfully targets to prevent a subsequent infection. It also reduces cytotoxicity and inflammation even after repeated usage [ 25 , 37 , 56 ].

3.4.2. Nucleic Acid-Based Molecules

Aptamers are compounds that can bind with targeted molecules with a high affinity. They have characteristic features similar to antibodies; they fold in a different sequence-specific conformation determined by the target agents [ 91 ]. Several aptamer compounds have been proposed as antiviral agents in different infectious diseases, including HIV, cytomegalovirus, and recently against glycoproteins of HSV viruses [ 61 ]. RNA aptamers are major candidates under study that exhibit the antiviral potential to neutralize HSV species. Their highly specific nature allows scientists to define and manufacture specifically targeted aptamers that do not show a reaction against other viruses [ 61 , 91 , 92 ].

Dermaseptins

These form a family of associated poly cationic peptides derived from frog species. They exhibit antiviral properties against HSV species [ 93 ]. They interfere with the virus–host interaction owing to the positively charged amino acids that bind with the opposing negative charged heparin sulfate molecules of host cells [ 36 , 55 , 56 , 93 ]. Experiments showed they were effective against acyclovir-resistant HSV-1 species and had a reduced cytotoxic profile. They work well at low pH levels, which may allow them to remain active in the genital tract [ 55 , 56 ]. Some important cation ion peptides belonging to dermaseptins are indicated in Table 2 .

3.4.3. Viral Glycoprotein Targeting Therapeutics

As explained earlier, virus surface glycoproteins play an important function in fusion and viral entry into the host cell. They are positively charged molecules; hence, polyanionic compounds with negative charges could be designed and used to inhibit HSV fusion and replication in vitro by targeting the glycoprotein/sulfate compound complex [ 27 , 30 , 31 , 32 ]. Some important polyanionic compounds that have been used in research experiments are described briefly below.

Nanoparticles with Affinity to Bind GPs

Recent advances in nanotechnology-based therapeutics have presented newer methods for tackling viral infections. Hence, various experiments have been designed that may inculcate the properties of metallic nanostructure-based compounds with high affinity to bind viral glycoproteins [ 94 , 95 ]. As the virus binds to the HS with its surface gPs, a strategy could be devised simply by targeting the gPs. Some important nanoparticle species such as gold nanoparticles (AuNPs), tin oxide (SnO), zinc oxide (ZnO), mercaptoethane sulfonate (Au-MES), and some other important species are under research [ 94 , 95 , 96 , 97 ]. Moreover, the latest studies have demonstrated dual effectivity in terms of viral fusion inhibition and immune stimulation to protect against viral diseases. The overall effect is reduced virus entry, replication, transmission, mutation, and highly induced immune response against these virus infections. Moreover, the conjugation with other drugs and adjuvants may also provide added value to antiviral therapeutics [ 94 , 96 ].

K-5 and SP-510-50 Compounds

Since the presence of HSV-2 infection increases the likelihood of catching HIV-1 infection, therapeutics are being designed for a combined and simultaneous effect against both. In this regard, polyanionic K-5 compounds present a major therapeutic option to address this issue [ 30 , 31 ]. They work by inhibiting free virion infection by interfering with GPs and subsequently preventing cellular cross-transmission in vitro. With more advanced clinical experimentation, these compounds could be used against the sexual transmission of HSV and HIV diseases [ 48 ]. Similarly, SP-510-50 works as an antibody toward the gD of virus particles and, thus, provides antiviral infectivity in HSV patients. Their effect is bound to their dosage applicability for infection prevention [ 85 , 89 ]. They exhibited twofold better results compared to the commercial trifluoridine (TFT) using a lower dose. Moreover, the overall disease symptomology was reduced by their application [ 38 ].

Dendrimers are composed of an amino-acid or carbohydrate conformation that is arranged in macromolecular compositions. Like nanoparticles, they exhibit good antiviral activities for their size [ 58 ]. Moreover, their characteristics, such as ease of preparation, ability to display a wide variety of surface molecules, easier functionalization, and targeted effect against viral gPs and the host cell surface make them an important therapeutic candidate for HSV treatment [ 31 ]. The surface characteristics make them eligible to bind multiple drug regimens, with a high and multidrug payload. Their successful application against HSV is in research annals. The purpose of these trials is to properly establish the safety, tolerability, toxicity, and systematic pharmacokinetic properties of these agents [ 31 , 58 ]. Some important ongoing trials are shown in Table 2 .

3.4.4. Targeting the Downstream Signaling Cascades

Targeting various downstream molecules that conduct cell signaling to induce viral infection is an important strategy that has been the focus of cell biology and bioinformatics recently. These studies allow the exploration of wide-spectrum molecular entities that could be used to design targeted therapies [ 98 ]. For example, studies have demonstrated the mechanism of different viruses that use actin and myosin-dependent pathways for the internalization of viruses in the cell [ 99 ]. The same property is exhibited by HSV which is involved in phagocytic uptake by corneal fibroblasts and retinal epithelial cells [ 98 , 100 ]. The underlying mechanisms are controlled by various kinases such as cyclic AMP-dependent protein kinase A, Akt/PKB, and ribosomal kinases p70 and p85, which play important roles in establishing cellular fusion [ 98 , 99 , 101 ]. Thus, inhibitor therapies are being designed against PI3K kinases to regulate the cellular surfing, entry, and viral infection in targeted cells. Successful results have been acquired in vitro, while next-level studies are still ongoing.

3.5. Antimicrobial Peptides against HSV

Antimicrobial peptides (AMPs) are positively charged short oligopeptides found in virtually all organisms which exhibit diversity in structure and function. They are synthesized and processed to play a vital role in initial immune responses against injury and infections. Some examples of such AMPs in humans include defensins, transferrins, hepcidin, cathelicidins, human antimicrobial proteins, histones, AMP-derived chemokines, and antimicrobial neuropeptides. AMPs have widely been studied for their potential antiviral properties. Defensins have been shown to play a protective role against HSV by blocking virus entry and other stages of the virus life cycle [ 102 , 103 ]. Several studies have shown a vital role of AMPs against various viral infections; therefore, AMPs can be effectively used as excellent therapeutic agents against HSV [ 104 ].

3.6. Some of the Latest Therapeutic Options

3.6.1. compounds derived from marine resources (algal species).

The widespread HSV positivity in the human population has compelled the scientific community to continuously remain engaged in proposing different therapeutic regimens against HSV infections [ 21 , 46 , 48 ]. The traditionally used drugs such as acyclovir, ganciclovir, valaciclovir, and foscarnet are good options for HSV treatment; however, the development of drug resistance in patients and the ability for viruses to develop a mutation in strains has compelled scientists to look for other options [ 105 ]. Marine-based products, such as those derived from algal populations, bacterial species, fungal biomass, sponges, tunicates, echinoderms, and mollusk seaweeds, are important organisms from which these drug candidates are being derived [ 105 ]. Caulerpin is one of such candidate drugs that has its origin in marine algae and works well as an antioxidant, antifungal, antibacterial agent, and acetylcholinesterase (AChE) inhibitor [ 106 ]. It functions to inhibit the stages of the replication cycle [ 107 ]. Moreover, its application as an alternative to traditional acyclovir is under consideration. In addition to caulerpin, various other algal species (~40) are in research and development for exhibiting anti-HSV properties in resistant infections. They exhibit antiviral activity ranging from 50% to 80% for both species of HSV [ 21 , 46 , 48 , 105 , 106 ]. Different algae with antiviral properties are shown in Table 2 . These studies allow the scientific community to delve deeper into marine-based and plant-based products to find a cure for HSV.

3.6.2. Mucus Penetrating Particles

Since mucus formation is an unfortunate characteristic of the common summer cold, concurrent HSV and common cold infections could present a hurdle in drug delivery and penetration of the targeted cells [ 95 ]. Owing to the mucoadhesive characteristics exhibited by common drugs, some studies have been conducted to design mucous penetrating particles mainly based on nanoparticles. These neoformations easily penetrate the tissues of the sinuses and vagina and, thus, establish successful delivery of drugs to tissues of interest [ 95 , 96 ]. Moreover, they provide the opportunity to surface coat the particles with multiple antiviral drugs and enable better absorption of the nanosized particles for a more profound effect. Overall, MPPs improved drug binding, distribution, retention, and dosages, as well as reduced toxicity, in HSV model experiments [ 95 , 96 , 108 ].

3.6.3. Plant-Derived Therapeutic Options

Similar to algal-derived drug candidates, some recent studies have indicated the therapeutic potential of some plant-based products ( Table 2 ). Like other drug regimens, they inhibit the virus entry and replication cycle by acting as potent inhibitors of various glycoproteins specific to different antiviral plant agents [ 109 ]. Antiviral agents such as neem bark extract (NBE) derived from Azardirachta indica and cyanovirin-n (CV-N) derived from Nostoc ellipsosporum, as well as peri-acylated gossylic nitriles derived from gossypol, are some of the important drug candidates exhibiting efficient anti-HSV profiles [ 42 , 47 , 48 , 109 , 110 ]. However, the potent anti-HSV profiling, toxicity studies, pharmacokinetic profiling, and antidrug comparative studies remain to be conducted in detail to provide the benefits associated with plant-based herbal therapies [ 109 ].

3.6.4. Combined Therapies

Knowing the scope of HSV disease implications, scientists are now gathering their research focus toward combined therapies since a certain specific drug or vaccine has not yet been shown to eradicate HSV infection [ 21 , 30 , 48 , 61 ]. Therefore, more integrated and coordinated efforts are being put forth in the form of combined therapies, where several drug combinations are checked for their effect against HSV. Most of the individual drug regimens have already gone through scientific examination to establish their antiviral character. Hence, the purpose of combined therapies is to only evaluate multiplex combined antiviral effects against HSV infection [ 46 , 48 ]. Various experiments in research annals have been carried out in vitro, in animal models, and in clinical trials. Similarly, more specific studies are in the research phase against proven anti-HSV drugs such as acyclovir and acycloguanosine in terms of evaluating their cytotoxic and pharmacokinetic profiles and upgrading them by nano-scaling or conjugating with nanoparticle formulations for effective low dosage implications [ 59 , 94 , 95 , 96 , 97 ]. These latest studies have provided a doorway to the resistance that develops over time in patients. The new formulation offers lower dosage, more targeted delivery, and enhanced efficacy in tested subjects. Therefore, the field of combined therapy against HSV is a major player in the future drug and vaccination designs against HSV. A brief overview of these therapeutic strategies against HSV have been covered in a summarized version in Table 2 below.

Ongoing trials for HSV drugs.

4. Conclusions

Several vaccines and drug trials are in progress against HSV. They provide a promising therapeutic potential in individual studies. However, no profound and specific therapy has been established until now that could tackle the problem of HSV infection worldwide. The need is to establish more coordinated and integrated studies with the cooperation of scientists, doctors, and pharmacies to take drug testing one step ahead in clinical practice. This is important because the expected viral mutations present the threat of the development of another mutant HSV that could then become another complication for HSV treatment and prevention. Therefore, the most effective approach for future therapeutic development will be to develop modern drug-design approaches such as those based on plant products and nanotechnology, and to carry out more combined therapies for large-scale and broad-spectrum antiviral and immunostimulatory effects so that HSV complications can be successfully addressed in the coming years.

Abbreviations

Funding Statement

This research received no external funding.

Author Contributions

Conceptualization, S.M. and Y.W.; methodology, S.M., R.S., K.M. and Y.W.; validation, S.M., O.A., R.S. and K.M.; formal analysis, S.M., O.A., R.S., K.M. and Y.W.; resources K.M. and Y.W.; data curation, S.M., O.A., R.S., K.M. and Y.W.; writing—original draft preparation, S.M.; writing—review and editing, S.M., K.M. and Y.W.; supervision, Y.W.; project administration, Y.W. funding acquisition, Y.W. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

Informed consent statement, data availability statement, conflicts of interest.

The authors declare no conflict of interest.

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

With a herpes vaccine on the horizon, will the stigma persist?

When I was 9 years old, I came down with a terrifying bout of pneumonia and ended up in the hospital for a week. I remember having a panic attack when I couldn’t catch my breath and my mother, scared, called a doctor for help. He arrived quickly and calmed me down with his gentle bedside manner. He helped me take deep, slow breaths through an oxygen mask, to the tune of his voice as he counted down from 10. I egged myself on, knowing I had to relax or I’d get transferred to the local children’s hospital.

A few days later, I arrived back at school. I was in fourth grade. I had recovered but still had trouble breathing. Whenever my immune system runs low, I’m at greater risk for a herpes outbreak , and that’s exactly what happened. My face had erupted in giant, oozing cold sores. During recess, I sat on a bench alone listening to Coldplay’s “Yellow” on my Walkman. A group of older, prettier and more popular girls approached me. I pulled one of my earbuds out to hear what they were saying, only to find they were taunting me. “AIDS Face.” “Pimple Mouth.” “Zit Lips.” 

I’ve had herpes for as long as I can remember, likely contracting the virus as a grabbing toddler reaching for my mother’s face.

As these cruel names were hurled at me, I trembled, cried and hugged my legs to my chest. When treating cold sores, time is of the essence. The second you feel a tingle, you need to treat the afflicted area. This helps mitigate the severity of the breakout . However, for a period of my childhood, I chose inaction, too traumatized by the stigma to do anything about it anymore. Instead, I leaned into being the weird kid and a social pariah, allowing my face to be riddled with herpes. While being infected with the virus is common and technically not a big deal, I was astronomically ashamed and isolated. In pop culture, the word herpes is near synonymous with dirty and that’s how I felt — dirty.

I’ve had herpes for as long as I can remember, likely contracting the virus as a grabbing toddler reaching for my mother’s face. Over the decades, I have spent a considerable amount of time agonizing over how to skip work, school and social events. When hiding from the world, I have tried every home remedy, topical cream and ointment and antiviral drug available. Sadly, there is no cure for herpes, only options to limit or prevent outbreaks . But a new vaccine on the horizon could prove to be a game changer.

Moderna is developing a vaccine using mRNA technology to treat the herpes simplex virus (HSV). There are two HSV virus types — HSV-1, the one I have, that affects the mouth, face and genitals, and HSV-2, which predominantly affects the genitals. However, both viruses can spread to other parts of the body. In the United States, of people aged 14 to 49, 47.8 percent have HSV-1 and 11.9 percent have HSV-2 , according to the Centers for Disease Control and Prevention. Many people living with herpes don’t know they have it, which means these figures may be far greater. HSV remains latent in the body , staying alive through the lifelong infection of a given person. When reactivated, HSV results in visible outbreaks. The vaccine will protect against HSV-2 and provide cross-protection for HSV-1 as a suppressive antiviral treatment.

The CDC recommends against widespread testing for herpes as, alongside the risk of false positives, “the risk of shaming and stigmatizing people outweighs the potential benefits.” Throughout my life, the social stigma surrounding herpes has proven more disastrous for my mental health than the virus itself. For so long, I assumed I wasn’t likable, let alone loveable. I believed I would be consigned to a life without sex and intimacy, having internalized harmful myths about a generally harmless infection. When I’ve had an outbreak, I’ve often chosen abstinence over disclosure, too fearful of rejection to open up. Interestingly, many people don’t even realize that having had chickenpox or shingles means they’ve been infected by a member of the herpes family . (Moderna is also developing a vaccine that would reduce the rate of the varicella-zoster virus that causes shingles.) But it’s the sexual component of HSV-1 and 2 that remains socially lethal.

The CDC recommends against widespread testing for herpes as, alongside the risk of false positives, “the risk of shaming and stigmatizing people outweighs the potential benefits.”

Much of the hysteria affecting the social status of herpes has been generated by the media and pharmaceutical companies. A 1982 TIME magazine cover labeled genital herpes “Today’s Scarlet Letter.” Authors of the cover story , John Leo and Maureen Dowd, posited that it could cause the sexual revolution to grind to a shrieking halt. Even more dramatic, the story argued that herpes was “altering sexual rites in America, changing courtship patterns, sending thousands of sufferers spinning into months of depression and self-exile and delivering a numbing blow to the one-night stand.”

Given the stigma around HIV at the time, perhaps the increased awareness about herpes did make some people change their sexual behaviors, but we also know that any activity that was deemed sexually deviant was used as a scapegoat to make sex seem shameful. A 2016 Vice exposé found that, starting in the 1970s, there is evidence that “big pharma” likely conjured up and perpetuated stigma to increase sales of a new drug, one that couldn’t be used to treat all members of the herpes family. To advertise the drug, herpes had to be pushed as a disease worthy of attention, the answer to which was a sex panic.

In the age of medical misinformation, vaccines themselves are misunderstood. For example, in general, they have been said to cause autism, despite no scientific evidence. The misinformation seems to increase when it comes to newly available ones; look no further than conspiracy theories swirling around Covid-19 vaccines , which were rumored to contain infertility agents or spread HIV — another notoriously stigmatized STI. The mRNA technology used to create these life-saving Covid-19 vaccines opened up the door for those Moderna is currently developing to treat herpes. In the near future, it’s possible that people will be prevented from ever getting herpes and that those with it won’t have to suffer through outbreaks anymore. I’ve wondered if the social stigma will persist and if kids like myself will be spared the pain I have experienced since childhood.

Deidre Olsen is an award-nominated writer based in Berlin. She is writing a memoir about self-destruction, healing and resilience.

• Genital Herpes
• Common Signs of Herpes
• HSV-1 and HSV-2
• Testing for Genital Herpes
• Preparing for Your Doctor Visit
• Living With
• Support & Resources
• View Full Guide

Genital Herpes Treatments in the Pipeline

Researchers are hard at work on new treatments to fight genital herpes, otherwise known as herpes simplex virus 2.

Microbicides are one option scientists are exploring in the search for new genital herpes treatments . Microbicides are chemicals that protect against infection by killing microbes (small organisms such as bacteria and viruses) before they enter the body. Two products show some promise -- tenofovir gel and siRNA nanoparticles -- microbicides that are applied to the vagina . Studies show these may be able to kill herpes , as well as some other sexually transmitted viruses, and even reduce the spread of the herpes virus from person to person.

Pritelivir is a new class of drugs that targets the DNA of the virus and stops it from replicating.  It has received FDA approval and is taken orally each day.

Scientists also are working on other new drugs that keep the herpes virus from replicating. To replicate (make copies of itself), a virus has to duplicate its DNA exactly. Scientists hope these new drugs will prevent the virus from doing that.

Everyone would like a vaccine that protects against HSV-2, but experimental products have had mixed and somewhat discouraging results.

Clinical Trials: Key to Genital Herpes Research

Although these new genital herpes treatments are just on the horizon, it may be years before any are available to consumers.

The process of introducing a new treatment to the public can be a long one. Before the FDA approves a drug, it must go through rigorous clinical trials , which are divided into three phases. In phase I, researchers try to find out if the drug is safe for people to take. If the drug is deemed safe, it may go on to phase II, when researchers aim to determine if the drug works as it should. They also collect more safety data. In phase III trials, they expand their research to include more patients in more places.

To conduct a clinical trial, scientists need people to participate voluntarily. Clinical trials often involve thousands of patients who volunteer to take the experimental drug. The FDA and an independent review board carefully monitor every aspect of the trial. There are rules the researchers must follow to ensure that their work is scientifically correct and ethically sound. Study volunteers have clearly defined rights, such as the right to drop out of the trial at any time.

While there are risks involved in joining a clinical trial, there may be benefits, too. You might get a new "wonder drug" long before it hits the market. If you're interested, ask your doctor if you could benefit by joining one. Your doctor may know of a trial that is seeking volunteers in your area. The National Institutes of Health also has an online database that you can search. This web site provides detailed information on what's involved in joining a clinical trial.

• What Are the Treatments?
• Treatment Options
• Medication Chart
• Home Treatments
• Alternative Treatments
• Clinical Trials
• Future Treatments

Top doctors in ,

Find more top doctors on, related links.

• Genital Herpes News
• Genital Herpes Reference
• Genital Herpes Slideshows
• Genital Herpes Medications
• Find an Urologist
• WebMDRx Savings Card
• Birth Control
• Drug Interaction Checker
• Genital Herpes Questions and Answers
• Herpes and HIV
• Herpes and Pregnancy
• Sex and Relationships
• Sexual Conditions
• More Related Topics

Researchers discover new method to treat herpes viruses

• Download PDF Copy

Researchers at Lund University in Sweden have discovered a new method to treat human herpes viruses. The new broad-spectrum method targets physical properties in the genome of the virus rather than viral proteins, which have previously been targeted. The treatment consists of new molecules that penetrate the protein shell of the virus and prevent genes from leaving the virus to infect the cell. It does not lead to resistance and acts independently of mutations in the genome of the virus. The results are published in the journal PLOS Pathogenes .

Herpes virus infections are lifelong, with latency periods between recurring reactivations, making treatment difficult. The major challenge lies in the fact that all existing antiviral drugs to treat herpes viruses lead to rapid development of resistance in patients with compromised immune systems where the need for herpes treatment is the greatest (e.g. newborn children, patients with HIV, cancer or who have undergone organ transplantation). Both the molecular and physical properties of a virus determine the course of infection. However, the physical properties have so far received little attention, according to researcher Alex Evilevitch.

"We have a new and unique approach to studying viruses based on their specific physical properties. Our discovery marks a breakthrough in the development of antiviral drugs as it does not target specific viral proteins that can rapidly mutate, causing the development of drug resistance - something that remains unresolved by current antiviral drugs against herpes and other viruses. We hope that our research will contribute to the fight against viral infections that have so far been incurable", says Alex Evilevitch, Associate Professor and senior lecturer at Lund University who, together with his research team, Virus Biophysics, has published the new findings.

The virus consists of a thin protein shell, a capsid, and inside it lies its genome, the genes. Alex Evilevitch has previously discovered that the herpes virus has high internal pressure because it is tightly packed with genetic material.

The pressure is 20 atmospheres, which is four times higher than in a champagne bottle and this allows herpes viruses to infect a cell by ejecting its genes at high speed into the cell nucleus after the virus has entered the cell. The cell is then tricked into becoming a small virus factory that produces new viruses that can infect and kill other cells in the tissue, leading to different disease states." Alex Evilevitch, Associate Professor and Senior Lecturer at Lund University

He, with the help of preclinical studies at the National Institutes of Health in the United States, has identified small molecules that are able to penetrate the virus and "turn off" the pressure in the genome of the virus without damaging the cell. These molecules proved to have a strong antiviral effect that was several times higher than the standard treatment against certain herpes types with the drug Aciclovir, as well as against resistant herpesvirus strains where Aciclovir does not work. The approach prevented viral infection.

Since all types of herpes viruses have similar structure and physical properties, this antiviral treatment works on all types of viruses within the herpes family.

Related Stories

• Research shows brain synchronization between humans and dogs
• Garlic’s antioxidant and nitric oxide boosting effects may help lower blood pressure
• Allen Institute and NYSCF launch collaboration to create inclusive cellular models

"The drugs available today for combatting viral infections are highly specialised against the viral proteins, and if the virus mutates, which regularly occurs, the drug is rendered ineffective. However, if you succeed in developing a treatment that attacks the physical properties of a virus, such as lowering the pressure inside the herpes virus shell, it should be possible to counter many different types of viral infections within the same virus family using the same drug. In addition, it would work even if the virus mutates because the mutations do not affect the internal pressure of the herpes virus.

"The result of the present study is a first step towards the goal of developing a drug and we already have positive preliminary data showing that a herpes infection can be stopped for all types of herpes virus including the resistant strains."

Lund University

Brandariz-Nuñez, A., et al. (2020) Pressurized DNA state inside herpes capsids—A novel antiviral target. PLOS Pathogens. doi.org/10.1371/journal.ppat.1008604 .

Posted in: Medical Science News | Medical Research News | Disease/Infection News

Tags: Aciclovir , B Cell , Cancer , Capsid , Cell , Cell Nucleus , Champagne , Children , Drugs , Genes , Genetic , Genome , Herpes , HIV , Newborn , Preclinical , Protein , Research , Small Molecules , T-Cell , Virus

Suggested Reading

Cancel reply to comment

• Trending Stories
• Latest Interviews
• Top Health Articles

How can microdialysis benefit drug development

Ilona Vuist

In this interview, discover how Charles River uses the power of microdialysis for drug development as well as CNS therapeutics.

Global and Local Efforts to Take Action Against Hepatitis

Lindsey Hiebert and James Amugsi

In this interview, we explore global and local efforts to combat viral hepatitis with Lindsey Hiebert, Deputy Director of the Coalition for Global Hepatitis Elimination (CGHE), and James Amugsi, a Mandela Washington Fellow and Physician Assistant at Sandema Hospital in Ghana. Together, they provide valuable insights into the challenges, successes, and the importance of partnerships in the fight against hepatitis.

Addressing Important Cardiac Biology Questions with Shotgun Top-Down Proteomics

In this interview conducted at Pittcon 2024, we spoke to Professor John Yates about capturing cardiomyocyte cell-to-cell heterogeneity via shotgun top-down proteomics.

Latest News

Newsletters you may be interested in

Your AI Powered Scientific Assistant

Hi, I'm Azthena, you can trust me to find commercial scientific answers from News-Medical.net.

A few things you need to know before we start. Please read and accept to continue.

• Use of “Azthena” is subject to the terms and conditions of use as set out by OpenAI .
• Content provided on any AZoNetwork sites are subject to the site Terms & Conditions and Privacy Policy .
• Large Language Models can make mistakes. Consider checking important information.

Great. Ask your question.

Azthena may occasionally provide inaccurate responses. Read the full terms .

While we only use edited and approved content for Azthena answers, it may on occasions provide incorrect responses. Please confirm any data provided with the related suppliers or authors. We do not provide medical advice, if you search for medical information you must always consult a medical professional before acting on any information provided.

Your questions, but not your email details will be shared with OpenAI and retained for 30 days in accordance with their privacy principles.

Please do not ask questions that use sensitive or confidential information.

Read the full Terms & Conditions .

Provide Feedback

More From Forbes

Viral awakening: the hidden threat of human herpes 6 (hhv-6) in car t therapy.

• Share to Facebook
• Share to Twitter
• Share to Linkedin

Before any treatment, each clinician and patient must determine whether the anticipated benefits ... [+] outweigh the potential toll caused on the body. Study results published in Nature suggest that latent virus reactivation may be a valid point to consider for CAR T and other immunotherapies.

All medicine—from Tylenol to the latest innovations in cancer care—is a balance of risk and reward. Each person must ask if the anticipated benefits outweigh the potential damage to the body. This is no different for patients who undergo CAR T therapy, a novel cancer immunotherapy that has yielded promising results for certain types of lymphomas, leukemias and multiple myeloma. Among already known risks such as cytokine storm and neurotoxicity, it is also possible to stir up viral infection, according to new research.

A study published in Nature points to latent virus reactivation as an understudied but important complication of CAR T therapy to consider. The authors discover the mechanism for why, in rare cases, a previously sleeping strain of herpes virus (HHV-6) can awaken during the CAR T process.

Latent Virus Reactivation: Waking the Beast

Humans are exposed to a wide range of pathogens when young. While the symptoms of the initial infection may come and go, some viruses remain in the body for life, hiding their genetic information in host cells while waiting to strike. If the person’s immune system is acutely weakened or stressed, the dormant pathogen eagerly reactivates its viral replication cycle and triggers a wave of new symptoms or illness. This phenomenon—the revival of a virus that has entered an inactive state within a host's cells—is called latent virus reactivation.

Immunosuppression is a major trigger for these opportunistic viruses. The virus can take advantage of the imbalance between the virus and host, as there are fewer white blood cells to counter the attack. HIV/AIDS patients and organ transplant patients are particularly susceptible. In contrast, healthy people may not experience symptoms at all.

Best High-Yield Savings Accounts Of September 2023

Best 5% interest savings accounts of september 2023.

Human herpesviruses are common reactivation culprits. This family of nine viruses is known to establish latent infections in humans. Most people are exposed to at least one of these viruses by adulthood, but the clinical presentation of each pathogen differs. Table 1 lists the differences between primary infection and reactivation symptoms for each virus.

TABLE 1: Chart of all human herpesviruses, along with their initial presentation and reactivation ... [+] presentation. Reactivation can be life-threatening for immunocompromised patients in particular.

Human Herpes Virus-6, or HHV-6, is actually a collective name for two distinct viruses: HHV-6A and HHV-6B. Both viruses replicate in T cells, but more is known about HHV-6B than HHV-6A. Over 90% of the human population is infected by HHV-6B by the age of three. The virus spreads through person-to-person contact, especially in daycare centers. Initial infection leads to rosela infatum, a childhood illness characterized by high fever and a mild rash, while reactivation has been linked to various complications including encephalitis (brain inflammation).

Human Herpes Virus-6 and CAR T Therapy

Although herpes reactivation is well-documented in immunocompromised patients, the latest cell therapies have yet to accumulate such data due to a lack of routine surveillance. These treatments rely on chemotherapy drugs to wipe out existing immune cells in the body. While the process prepares the patient for their cell infusion, it simultaneously weakens the body and leaves the patient susceptible to viral reactivation.

This is true for This is true for C himeric A ntigen R eceptor T cell (CAR T) therapy, which the FDA approved in 2017 for treating resistant/refractory blood cancers. Some reports suggest that CAR T therapy can spark cytomegalovirus and HHV-6 reactivation and may cause subsequent neurotoxicity , but the specifics remain unknown.

HHV-6 Present in T Cells

Stanford University researchers recently chipped away at this mystery. In their paper, they relied on large-scale genomic analyses of viruses and single-cell RNA sequencing to understand why HHV-6 reactivates in a minority of CAR T cell patients.

Combing through Serratus, a cloud resource of all publicly available viral sequences, the team realized that HHV-6 RNA is expressed more than any other viral RNA in T cells. Then, they isolated white blood cells from healthy donors to mimic the CAR T cell process. The therapy usually entails extracting T cells from a patient; the cells are altered and proliferated in a lab to improve their cancer-fighting abilities; as previously mentioned, patients then undergo a preparatory course of chemotherapy before receiving their infusion of modified T cells. The experiment revealed that HHV-6 expression can increase in some T cells. A combination of various cues in the cells and during the manufacturing process likely upregulates a T cell receptor (OX40) the herpes virus uses to enter the cell.

Next came a cell culture analysis, a comparison of viral and human gene expression in the T cell populations of three healthy donors. The results showed that 0.1-0.3% of all the cells in culture reactivated or expressed HHV-6 at high levels. These HHV-6 “super-expresser” cells are mainly confined to CD4+ “helper” T cells, a subset of T white blood cells. Two of the donor samples were tested again several days later; on Day 25 or Day 27, the percentage of super-expressors increased to 49% and 62% of all T cells, demonstrating how a tiny collection of super-expressors can spread to other T cells in the population (including CD8+ “killer” T cells, another T cell subset).

CAR T Cells Reactivate HHV-6

The team sought to understand how HHV-6 activation occurs in patients instead of cell cultures. Samples were taken from patients who underwent either FDA-approved or clinical trial CAR T products. All 76 samples were screened before CAR T cell infusion and after. Although none of the cells expressed HHV-6 prior to infusion, 28 cells expressed HHV-6 post-infusion. Additional testing suggested that HHV-6 can be detected between two and three weeks after the initial manufacture of the CAR T cell product.

Some experimental, ready-made CAR T therapies depend on T cells instead of the patient’s own T cells. Could HHV-6 be reactivated in these cases, too? The analysis of a single patient treated with ready-made CAR T cells reported HHV-6 expression on Days 14 and 19, suggesting that the longer duration needed to culture ready-made CAR T cells may increase HHV-6 expression.

The team also assessed if foscarnet, an intravenous medication used to treat certain herpesviruses, could lessen HHV-6 viral load. Donor-derived CAR T cells either received foscarnet or nothing on Day 24 of manufacturing. The results indicate a lower viral RNA abundance for foscarnet-treated cells than those with the untreated control.

FIGURE 1: A schematic of tested CAR T therapies, including FDA-approved (Yescarta, Kymirah) and ... [+] experimental (SJCAR19) products. HHV-6 is undetected in all products prior to infusion.

CAR T therapy can be transformative for many patients who qualify for it. Indeed, most patients will likely elect the therapy despite the risk of latent viral reactivation. However, gathering more knowledge on this understudied complication could minimize potential dangers.

HHV-6 reactivation in particular is poorly understood despite anecdotes of encephalitis and other toxicities in CAR T patients. By investigating the mechanism behind this reactivation, this paper lays a foundation of viral dynamics for current and future CAR T therapies to consider: both host cells and CAR T products can amplify pools of HHV-6 depending on the timing and conditions of each patient. As the authors test, antiviral medications may mitigate this rare threat; not mentioned is mRNA and lipid nanoparticle technology , a potentially superior alternative that turns T cells into CAR T cells inside the body instead of in the lab. This direct infection could forgo traditional lymphodepleting chemotherapy altogether.

• Editorial Standards
• Forbes Accolades

Join The Conversation

One Community. Many Voices. Create a free account to share your thoughts. 

Forbes Community Guidelines

Our community is about connecting people through open and thoughtful conversations. We want our readers to share their views and exchange ideas and facts in a safe space.

In order to do so, please follow the posting rules in our site's  Terms of Service.   We've summarized some of those key rules below. Simply put, keep it civil.

Your post will be rejected if we notice that it seems to contain:

• False or intentionally out-of-context or misleading information
• Insults, profanity, incoherent, obscene or inflammatory language or threats of any kind
• Attacks on the identity of other commenters or the article's author
• Content that otherwise violates our site's  terms.

User accounts will be blocked if we notice or believe that users are engaged in:

• Continuous attempts to re-post comments that have been previously moderated/rejected
• Racist, sexist, homophobic or other discriminatory comments
• Attempts or tactics that put the site security at risk
• Actions that otherwise violate our site's  terms.

So, how can you be a power user?

• Stay on topic and share your insights
• Feel free to be clear and thoughtful to get your point across
• ‘Like’ or ‘Dislike’ to show your point of view.
• Protect your community.
• Use the report tool to alert us when someone breaks the rules.

Thanks for reading our community guidelines. Please read the full list of posting rules found in our site's  Terms of Service.

Kiran Sarvepalli V27 Develops Protocol to Detect Pathogens in FFPE Tissue Samples in Summer Research Program

Every summer, first- and second-year students at Cummings School of Veterinary Medicine at Tufts University participate in the Student Summer Research Training Program . Students pair up with faculty members to create a project that augments the research happening in Cummings School laboratories. Under a professor’s mentorship, each student conducts their research throughout the summer and generates a poster of their work to present at the National Veterinary Scholars Symposium (NVSS) and at Cummings School’s Veterinary Research Day, held this year on September, 6. Kiran Sarvepalli, V27’s research took an especially interesting turn this summer and led him to devise an effective protocol for two laboratories on campus to analyze banked tissue samples.

Kiran set his sights on a career in veterinary medicine in high school when he took his first biology course. Growing up in Fairfax, Virginia, he always liked catching reptiles and amphibians. While earning his Bachelor of Science in Biology from Carnegie Mellon University, he conducted research in computational biology, predicting how a molecule would fragment in a mass spectrometer and identifying the molecular structure of organic compounds.

He was drawn to Cummings School by Tufts Wildlife Clinic and the strong exotic wildlife program. The Summer Research Program appealed to Kiran as a way to incorporate his interest in wildlife with research. A few months into his first semester, he reached out to Dr. Amanda Martinot (she/her), E.A. Stevens Associate Professor in the Department of Infectious Disease & Global Health and co-director of Comparative Pathology and Genomics Shared Resource in the Department of Comparative Pathobiology , where she holds a joint appointment as a board-certified veterinary anatomic pathologist. The primary research focus of Dr. Martinot’s Lab centers on infectious diseases, such as tuberculosis and SARS-CoV-2, and the development of live-attenuated vaccines for tuberculosis. Dr. Martinot also supports other research groups by developing and validating animal models by evaluating tissue pathology.

“The Summer Research Program is incredible,” says Dr. Martinot. “I’m always so impressed with the caliber of students. It’s a great way to connect with students potentially interested in research and excited about the possibility of pursuing research as part of their career in veterinary medicine.”

Dr. Martinot describes the process for students to become a part of the Summer Research Program, “We talk to students about what they’re interested in, what they’d like to get out of the experience, what the lab is doing, and how we can craft a project that’s exciting for them.”

With Kiran’s interests in wildlife and conservation medicine, Dr. Martinot looked beyond what was happening in her lab to projects she collaborates on with other labs, including her work with Dr. Marieke Rosenbaum , (she/her) assistant professor of Veterinary Public Health in the Department of Infectious Disease & Global Health and assistant professor in the Department of Public Health and Community Medicine at Tufts School of Medicine. She analyzes samples from wild-caught monkeys in Peru to study infectious diseases in trafficked primates.

Dr. Rosenbaum has worked with students for years to assist with her research. “The Summer Research Program is a huge opportunity to move forward smaller parts of a research project and helpful to round out the research and fill in the gaps. Students quickly become competent—doing their own trouble-shooting, bringing different ideas, and becoming proficient in that topic area. It’s fun and advances the research that we’re doing.”

Working with two mentors across two labs was a fit for Kiran’s summer research project: “Detection of Herpes Simplex Virus One (HSV-1) in FFPE Samples from Neotropical Primates.”

“The transfer of pathogens from animals to humans isn’t considered as often as the opposite, from humans to animals,” explains Kiran. “But those infections can be just as devastating. HSV-1 is pretty ubiquitous in human populations, but when it’s transferred to primates, it can be fatal. We’re concerned with how it’s transmitted and how primates can get infected. My project is on the pathology of what happens when a primate is infected with HSV-1.”

Kiran originally set out to use RNAscope in situ hybridization to detect HSV-1 in primates’ tissue samples. Checking in with him in mid-summer, he reported that doing so proved to be a bigger challenge than anticipated and he changed direction on his original goal and hypothesis.

Kiran analyzed formalin-fixed paraffin-embedded (FFPE) tissue samples from the Peruvian monkeys. While the FFPE process is essential to deactivate any pathogens to prevent the spread of potential diseases, it also compromises the integrity of DNA and RNA. He initially found the DNA extracted from the FFPE tissues of poor quality, making downstream polymerase chain reaction (PCR) difficult and inconsistent, so this aspect of the project took much longer than expected.

“Every day I’m in the lab, hands-on, doing research that makes you think in ways maybe you hadn’t thought before,” says Kiran. “If the PCR doesn’t work, what factors can we change next time around? It can be frustrating, but it is also very satisfying when the protocol works. The best part of research is getting the result.”

Kiran decided to take his research in a new direction—how to optimize techniques using PCR to detect HSV-1 in FFPE-embedded tissues. “There’s a lot of information in these FFPE bio-banked tissue samples and they can last almost indefinitely, but we need to extract the DNA to understand the pathology. My part is to optimize the protocols that will be useful for Dr. Martinot and Dr. Rosenbaum down the road.”

Dr. Rosenbaum explains his work, “Kiran is helping to develop ways to better detect and demonstrate that HSV-1 is infecting primates and ending up in their tissues. Some animals don’t develop the disease and others die from it. Kiran is developing assays and probes to look at tissues and how HSV is behaving in primates.”

Kiran generated a poster of his work and presented it at the National Veterinary Scholars Symposium (NVSS) in St. Paul, Minnesota in early August with his fellow Summer Research Program students. He liked meeting veterinary students from across the country and around the world and seeing their research. He was struck by the diversity of research happening—from translational human medicine to conservation work to data analysis of antibiotic resistance.

At the end of the summer, Kiran reported that when he initially ran the RNAscope in situ hybridization, he was unable to see a certain signal of the RNA and DNA and assumed the protocol had not worked. He switched to a more robust microscope and could then see the results properly, though the technique still needed optimization, which became his focus for the rest of the program.

“One thing I accomplished is establishing the PCR protocol to detect the herpes virus in FFPE tissues,” says Kiran. “It’s important to help people in labs to screen tissues for the herpes virus. It’s useful to have, so I’m happy about that.”

This protocol brings tremendous value to both Dr. Martinot’s and Dr. Rosenbaum’s laboratories.

“Kiran developed a method to extract DNA to analyze tissues,” says Dr. Martinot. “He did a great job developing a protocol that’s very useful for a lot of reasons. Anyone who has access to these tissue block archives can use this method to extract DNA from the fixed tissues. He got the protocol to work, extracted DNA, and developed an in-situ hybridization protocol to show that tissues with active virus-producing RNA also had pathology, and we can appreciate it through a microscope. It’s about connecting the dots.”

Dr. Rosenbaum explains how Kiran’s work contributes to her research, “It allows us to better understand how the virus behaves in those monkeys and the pathophysiology of the herpes virus in primates. When we find herpes in monkeys, we need to be able to prove that it’s HSV-1. The more we can characterize tissues and how they are infected, the more concrete evidence we have that it’s the cause of infections. Kiran’s work helps to do that.”

In addition to presenting their work at NVSS and Cummings School’s Veterinary Research Day, students in the Summer Research Program also attend weekly seminars with biomedical researchers—from lab animal veterinarians to government researchers, from the corporate sector to academia—to learn about careers in veterinary research and new research approaches and techniques.

“Overall, it was a very interesting summer and gave me a lot of experience that traditional vets don’t always have, as well as perspective on what you can do as a veterinarian,” says Kiran. “I’m not sure yet what I want to do, but it opens doors and understanding of what’s possible.”

Kiran hopes to continue his research in the lab, improving the protocol and analyzing tissue samples suspected of having HSV-1.

“It’s a small amount of time to generate data in six weeks; it’s a high bar for students to come out with something,” says Dr. Martinot. “They have to be resilient and patient. Kiran had those struggles, workshopped it, pivoted, and adjusted his techniques, and at the end of the day, came out with great results, the best possible outcome. I’m hoping to keep Kiran connected to the lab. I’m so impressed with the students that come through here; I never want any of them to leave.”

Information

• Author Services

Initiatives

You are accessing a machine-readable page. In order to be human-readable, please install an RSS reader.

All articles published by MDPI are made immediately available worldwide under an open access license. No special permission is required to reuse all or part of the article published by MDPI, including figures and tables. For articles published under an open access Creative Common CC BY license, any part of the article may be reused without permission provided that the original article is clearly cited. For more information, please refer to https://www.mdpi.com/openaccess .

Feature papers represent the most advanced research with significant potential for high impact in the field. A Feature Paper should be a substantial original Article that involves several techniques or approaches, provides an outlook for future research directions and describes possible research applications.

Feature papers are submitted upon individual invitation or recommendation by the scientific editors and must receive positive feedback from the reviewers.

Editor’s Choice articles are based on recommendations by the scientific editors of MDPI journals from around the world. Editors select a small number of articles recently published in the journal that they believe will be particularly interesting to readers, or important in the respective research area. The aim is to provide a snapshot of some of the most exciting work published in the various research areas of the journal.

Original Submission Date Received: .

• Active Journals
• Find a Journal
• Journal Proposal
• Proceedings Series
• For Authors
• For Reviewers
• For Editors
• For Librarians
• For Publishers
• For Societies
• For Conference Organizers
• Open Access Policy
• Institutional Open Access Program
• Special Issues Guidelines
• Editorial Process
• Research and Publication Ethics
• Article Processing Charges
• Testimonials
• Preprints.org
• SciProfiles
• Encyclopedia

Article Menu

• Subscribe SciFeed
• Recommended Articles
• Google Scholar
• on Google Scholar
• Table of Contents

Find support for a specific problem in the support section of our website.

Please let us know what you think of our products and services.

Visit our dedicated information section to learn more about MDPI.

JSmol Viewer

Viral etiology of aseptic meningitis and clinical prediction of herpes simplex virus type 2 meningitis.

1. Introduction

2.1. patients and methods, 2.2. statistical analyses, 3.1. demographic features and etiology of aseptic meningitis, 3.2. clinical and laboratory characteristics, 3.3. prediction of hsv-2 meningitis, 4. discussion, supplementary materials, author contributions, institutional review board statement, informed consent statement, data availability statement, conflicts of interest.

• Tapiainen, T.; Prevots, R.; Izurieta, H.S.; Abramson, J.; Bilynsky, R.; Bonhoeffer, J.; Bonnet, M.-C.; Center, K.; Galama, J.; Gillard, P.; et al. Aseptic meningitis: Case definition and guidelines for collection, analysis and presentation of immunization safety data. Vaccine 2007 , 25 , 5793–5802. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Aldriweesh, M.A.; Shafaay, E.A.; Alwatban, S.M.; Alkethami, O.M.; Aljuraisi, F.N.; Bosaeed, M.; Alharbi, N.K. Viruses Causing Aseptic Meningitis: A Tertiary Medical Center Experience with a Multiplex PCR Assay. Front. Neurol. 2020 , 11 , 602267. [ Google Scholar ] [ CrossRef ]
• Wang, X.; Theodore, M.J.; Mair, R.; Trujillo-Lopez, E.; du Plessis, M.; Wolter, N.; Baughman, A.L.; Hatcher, C.; Vuong, J.; Lott, L.; et al. Clinical validation of multiplex real-time PCR assays for detection of bacterial meningitis pathogens. J. Clin. Microbiol. 2012 , 50 , 702–708. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Petersen, P.T.; Bodilsen, J.; Jepsen, M.P.G.; Larsen, L.; Storgaard, M.; Hansen, B.R.; Helweg-Larsen, J.; Wiese, L.; Lüttichau, H.R.; Andersen, C.; et al. Clinical features and prognostic factors in adults with viral meningitis. Brain 2023 , 146 , 3816–3825. [ Google Scholar ] [ CrossRef ]
• Kohil, A.; Jemmieh, S.; Smatti, M.K.; Yassine, H.M. Viral meningitis: An overview. Arch. Virol. 2021 , 166 , 335–345. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Bodilsen, J.; Tattevin, P.; Tong, S.Y.C.; Naucler, P.; Nielsen, H. Treatment of Herpes Simplex Virus Type 2 Meningitis: A Survey Among Infectious Diseases Specialists in France, Sweden, Australia, and Denmark. Open Forum. Infect. Dis. 2022 , 9 , ofac644. [ Google Scholar ] [ CrossRef ]
• Han, S.-H.; Choi, H.-Y.; Kim, J.-M.; Park, K.-R.; Youn, Y.C.; Shin, H.-W. Etiology of aseptic meningitis and clinical characteristics in immune-competent adults. J. Med. Virol. 2016 , 88 , 175–179. [ Google Scholar ] [ CrossRef ]
• de Ory, F.; Avellón, A.; Echevarría, J.; Sánchez-Seco, M.; Trallero, G.; Cabrerizo, M.; Casas, I.; Pozo, F.; Fedele, G.; Vicente, D.; et al. Viral infections of the central nervous system in Spain: A prospective study. J. Med. Virol. 2013 , 85 , 554–562. [ Google Scholar ] [ CrossRef ]
• Shukla, B.; Aguilera, E.A.; Salazar, L.; Wootton, S.H.; Kaewpoowat, Q.; Hasbun, R. Aseptic meningitis in adults and children: Diagnostic and management challenges. J. Clin. Virol. 2017 , 94 , 110–114. [ Google Scholar ] [ CrossRef ]
• Kupila, L.; Vuorinen, T.; Vainionpaa, R.; Hukkanen, V.; Marttila, R.J.; Kotilainen, P. Etiology of aseptic meningitis and encephalitis in an adult population. Neurology 2006 , 66 , 75–80. [ Google Scholar ] [ CrossRef ]
• McGill, F.; Griffiths, M.J.; Bonnett, L.J.; Geretti, A.M.; Michael, B.D.; Beeching, N.J.; McKee, D.; Scarlett, P.; Hart, I.J.; Mutton, K.J.; et al. Incidence, aetiology, and sequelae of viral meningitis in UK adults: A multicentre prospective observational cohort study. Lancet Infect. Dis. 2018 , 18 , 992–1003. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Smith, J.S.; Robinson, N.J. Age-specific prevalence of infection with herpes simplex virus types 2 and 1: A global review. J. Infect. Dis. 2002 , 186 (Suppl. S1), S3–S28. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Puchhammer-Stöckl, E.; Aberle, S.W.; Heinzl, H. Association of age and gender with alphaherpesvirus infections of the central nervous system in the immunocompetent host. J. Clin. Virol. 2012 , 53 , 356–359. [ Google Scholar ] [ CrossRef ]
• AlMukdad, S.; Harfouche, M.; Wettstein, A.; Abu-Raddad, L.J. Epidemiology of herpes simplex virus type 2 in Asia: A systematic review, meta-analysis, and meta-regression. Lancet Reg. Health West. Pac. 2021 , 12 , 100176. [ Google Scholar ]
• Sejvar, J.J.; Kohl, K.S.; Bilynsky, R.; Blumberg, D.; Cvetkovich, T.; Galama, J.; Gidudu, J.; Katikaneni, L.; Khuri-Bulos, N.; Oleske, J.; et al. Encephalitis, myelitis, and acute disseminated encephalomyelitis (ADEM): Case definitions and guidelines for collection, analysis, and presentation of immunization safety data. Vaccine 2007 , 25 , 5771–5792. [ Google Scholar ] [ CrossRef ]
• Ihekwaba Ugo, K.; Kudesia, G.; McKendrick Michael, W. Clinical Features of Viral Meningitis in Adults: Significant Differences in Cerebrospinal Fluid Findings among Herpes Simplex Virus, Varicella Zoster Virus, and Enterovirus Infections. Clin. Infect. Dis. 2008 , 47 , 783–789. [ Google Scholar ] [ CrossRef ]
• Nahdi, I.; Boukoum, H.; Ben Salem, A.N.; Ben Romdane, F.; Hammami, S.; Chebel, S.; Mahbouba, F.; Guediche, M.N.; Chakroun, M.; Aouni, M.; et al. Detection of herpes simplex virus (1 and 2), varicella-zoster virus, cytomegalovirus, human herpesvirus 6 and enterovirus in immunocompetent Tunisian patients with acute neuromeningeal disorder. J. Med. Virol. 2012 , 84 , 282–289. [ Google Scholar ] [ CrossRef ]
• Yoo, M.; Wang, J.-S.; Park, S.-J.; Cha, J.-O.; Jung, Y.; Chung, Y.-S.; Han, M.G.; Choi, B.-S.; Kim, S.-S.; Kee, M.-K. Characteristics of recent HIV infection among individuals newly diagnosed as HIV-positive in South Korea (2008–2015). Sci. Rep. 2022 , 12 , 10515. [ Google Scholar ] [ CrossRef ]
• Fleming, D.T.; McQuillan, G.M.; Johnson, R.E.; Nahmias, A.J.; Aral, S.O.; Lee, F.K.; Louis, M.E.S. Herpes simplex virus type 2 in the United States, 1976 to 1994. N. Engl. J. Med. 1997 , 337 , 1105–1111. [ Google Scholar ] [ CrossRef ]
• Choi, R.; Kim, G.; Jo, I.J.; Sim, M.S.; Song, K.J.; Kim, B.J.; Na, D.L.; Huh, H.J.; Kim, J.; Ki, C.; et al. Incidence and clinical features of herpes simplex viruses (1 and 2) and varicella-zoster virus infections in an adult Korean population with aseptic meningitis or encephalitis. J. Med. Virol. 2014 , 86 , 957–962. [ Google Scholar ] [ CrossRef ]
• Chen, L.; Xu, Y.; Liu, C.; Huang, H.; Zhong, X.; Ma, C.; Zhao, H.; Chen, Y. Clinical features of aseptic meningitis with varicella zoster virus infection diagnosed by next-generation sequencing: Case reports. BMC Infect. Dis. 2020 , 20 , 435. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Ginsberg, L. Difficult and recurrent meningitis. J. Neurol. Neurosurg. Psychiatry 2004 , 75 (Suppl. S1), i16–i21. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Petersen, P.T.; Bodilsen, J.; Jepsen, M.P.G.; Hansen, B.R.; Storgaard, M.; Larsen, L.; Helweg-Larsen, J.; Wiese, L.; Lüttichau, H.R.; Andersen, C.Ø.; et al. Benign recurrent lymphocytic meningitis (Mollaret’s meningitis) in Denmark: A nationwide cohort study. Eur. J. Neurol. 2024 , 31 , e16081. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Picard, F.J.; Dekaban, G.A.; Silva, J.; Rice, G.P. Mollaret’s meningitis associated with herpes simplex type 2 infection. Neurology 1993 , 43 , 1722–1727. [ Google Scholar ] [ CrossRef ]
• Miller, S.; Mateen, F.J.; Aksamit, A.J., Jr. Herpes simplex virus 2 meningitis: A retrospective cohort study. J. Neurovirol. 2013 , 19 , 166–171. [ Google Scholar ] [ CrossRef ]
• Aurelius, E.; Franzen-Röhl, E.; Glimåker, M.; Akre, O.; Grillner, L.; Jorup-Rönström, C.; Studahl, M.; HSV-2 Meningitis Study Group. Long-term valacyclovir suppressive treatment after herpes simplex virus type 2 meningitis: A double-blind, randomized controlled trial. Clin. Infect. Dis. 2012 , 54 , 1304–1313. [ Google Scholar ] [ CrossRef ]
• Landry, M.L.; Greenwold, J.; Vikram, H.R. Herpes simplex type-2 meningitis: Presentation and lack of standardized therapy. Am. J. Med. 2009 , 122 , 688–691. [ Google Scholar ] [ CrossRef ]
• Hosny, A.; Parmar, C.; Quackenbush, J.; Schwartz, L.H.; Aerts, H. Artificial intelligence in radiology. Nat. Rev. Cancer 2018 , 18 , 500–510. [ Google Scholar ] [ CrossRef ]
• Wiens, J.; Shenoy, E.S. Machine Learning for Healthcare: On the Verge of a Major Shift in Healthcare Epidemiology. Clin. Infect. Dis. 2018 , 66 , 149–153. [ Google Scholar ] [ CrossRef ]
• Luz, C.F.; Vollmer, M.; Decruyenaere, J.; Nijsten, M.W.; Glasner, C.; Sinha, B. Machine learning in infection management using routine electronic health records: Tools, techniques, and reporting of future technologies. Clin. Microbiol. Infect. 2020 , 26 , 1291–1299. [ Google Scholar ] [ CrossRef ]
• Couronne, R.; Probst, P.; Boulesteix, A.L. Random forest versus logistic regression: A large-scale benchmark experiment. BMC Bioinform. 2018 , 19 , 270. [ Google Scholar ] [ CrossRef ] [ PubMed ]
• Doupe, P.; Faghmous, J.; Basu, S. Machine Learning for Health Services Researchers. Value Health 2019 , 22 , 808–815. [ Google Scholar ] [ CrossRef ] [ PubMed ]

Click here to enlarge figure

Share and Cite

Song, P.; Seok, J.M.; Kim, S.; Choi, J.; Bae, J.Y.; Yu, S.N.; Park, J.; Choi, K.; Yang, Y.; Jeong, D.; et al. Viral Etiology of Aseptic Meningitis and Clinical Prediction of Herpes Simplex Virus Type 2 Meningitis. J. Pers. Med. 2024 , 14 , 998. https://doi.org/10.3390/jpm14090998

Song P, Seok JM, Kim S, Choi J, Bae JY, Yu SN, Park J, Choi K, Yang Y, Jeong D, et al. Viral Etiology of Aseptic Meningitis and Clinical Prediction of Herpes Simplex Virus Type 2 Meningitis. Journal of Personalized Medicine . 2024; 14(9):998. https://doi.org/10.3390/jpm14090998

Song, Pamela, Jin Myoung Seok, Seungju Kim, Jaehyeok Choi, Jae Yeong Bae, Shi Nae Yu, Jongkyu Park, Kyomin Choi, Youngsoon Yang, Dushin Jeong, and et al. 2024. "Viral Etiology of Aseptic Meningitis and Clinical Prediction of Herpes Simplex Virus Type 2 Meningitis" Journal of Personalized Medicine 14, no. 9: 998. https://doi.org/10.3390/jpm14090998

Article Metrics

Supplementary material.

ZIP-Document (ZIP, 164 KiB)

Further Information

Mdpi initiatives, follow mdpi.

Subscribe to receive issue release notifications and newsletters from MDPI journals

• Alzheimer's disease & dementia
• Arthritis & Rheumatism
• Attention deficit disorders
• Autism spectrum disorders
• Biomedical technology
• Diseases, Conditions, Syndromes
• Endocrinology & Metabolism
• Gastroenterology
• Gerontology & Geriatrics
• Health informatics
• Inflammatory disorders
• Medical economics
• Medical research
• Medications
• Neuroscience
• Obstetrics & gynaecology
• Oncology & Cancer
• Ophthalmology
• Overweight & Obesity
• Parkinson's & Movement disorders
• Psychology & Psychiatry
• Radiology & Imaging
• Sleep disorders
• Sports medicine & Kinesiology
• Vaccination
• Breast cancer
• Cardiovascular disease
• Chronic obstructive pulmonary disease
• Colon cancer
• Coronary artery disease
• Heart attack
• Heart disease
• High blood pressure
• Kidney disease
• Lung cancer
• Multiple sclerosis
• Myocardial infarction
• Ovarian cancer
• Post traumatic stress disorder
• Rheumatoid arthritis
• Schizophrenia
• Skin cancer
• Type 2 diabetes
• Full List »

share this!

September 19, 2024

This article has been reviewed according to Science X's editorial process and policies . Editors have highlighted the following attributes while ensuring the content's credibility:

fact-checked

peer-reviewed publication

reputable news agency

US wastewater tests show bird flu virus limited to areas with farm animals

An extensive look at wastewater samples taken across the United States from May to July found traces of the H5N1 bird flu popping up—but only in areas populated by farm animals.

The avian flu virus has been widespread in U.S. poultry as well as herds of dairy cows, raising alarms that the virus might somehow mutate and spread between people.

The wastewater testing performed between May 12 and July 13 is reassuring, suggesting the virus is still centered on animals.

Nine of 41 states with wastewater detection of flu viruses in place showed sites with traces of the H5N1 virus present in samples, the CDC said.

However, "the nine states with H5 detections in wastewater included seven states with an HPAI A[H5N1]–infected herd reported during this period and one additional state with an infected herd reported before this period," the agency reported Sept. 19 in its journal Morbidity and Mortality Weekly Report.

Those nine states are California, Colorado, Idaho, Iowa, Michigan, Minnesota, North Carolina, South Dakota and Texas.

So far, there have only been 14 reported cases of human infection with H5N1, typically triggering minor illness, with almost all occurring among people in close contact with infected animals, such as dairy workers.

In the new wastewater report, "two of these nine states [Colorado and Michigan] reported confirmed human cases of HPAI A(H5N1) virus infection during this time," said the team led by Souci Louis, an investigator at the CDC's Epidemic Intelligence Service.

"Follow-up investigations in many of these states revealed likely animal-related sources, including those related to milk processing," the team concluded.

However, the researchers added that wastewater testing is not yet foolproof as to the source of virus, because "although influenza viruses can be detected in wastewater, current techniques cannot distinguish between human and animal sources."

The same team also looked for signs of influenza A viruses as a whole (of which H5N1 is a subtype). Influenza A viruses are linked to seasonal human flu.

The report found that during the early summer , "11 sites in four states [California, Illinois, Kansas and Oregon] reported high levels of influenza A virus," indicating regular flu was being passed around between people there.

"None of these four states reported H5 human influenza [ bird flu ] cases, nor did they report any confirmed cases in livestock herds or poultry within their sewer sheds or counties during this time," Louis's team noted.

Souci Louis et al, Wastewater Surveillance for Influenza A Virus and H5 Subtype Concurrent with the Highly Pathogenic Avian Influenza A(H5N1) Virus Outbreak in Cattle and Poultry and Associated Human Cases — United States, May 12–July 13, 2024, MMWR. Morbidity and Mortality Weekly Report (2024). DOI: 10.15585/mmwr.mm7337a1

2024 HealthDay. All rights reserved.

Explore further

Feedback to editors

Food fussiness a largely genetic trait from toddlerhood to adolescence, study suggests

8 hours ago

Vegans' intake of protein and essential amino acids is adequate but ultra-processed products are also needed: Study

10 hours ago

New combination treatment brings hope to patients with advanced bladder cancer

11 hours ago

Study reveals gaps in access to long-term contraceptive supplies

Researchers integrate individualized daily irradiation in proton therapy tumor treatment

Searching for a vaccine against an ancient scourge: Syphilis genetics study points to a potential target

12 hours ago

Key mechanism behind common genetic cause of age-related visual loss discovered

13 hours ago

New prostate biopsy technique lowers infection risk

Researchers discover potential target to treat severe anemia in patients unresponsive to standard treatments

Novel drug molecule could help treat Parkinson's disease in young patients

Related stories.

Avian flu found in wastewater of 10 Texas cities through virome sequencing

Sep 12, 2024

Signs of avian flu found in San Francisco wastewater

Jul 1, 2024

Avian flu first found in Central Valley is spreading, with new California cases confirmed

Sep 16, 2024

WHO urges more surveillance in bird flu fight

Jul 11, 2024

Avian flu has infected dairy cows in more than a dozen states—a microbiologist explains how the virus is spreading

Aug 29, 2024

Preparedness for HPAI A(H5N1) virus varies across jurisdictions

May 22, 2024

Recommended for you

Nationwide analysis finds mental health concerns are a huge part of primary care practice

14 hours ago

Flavonoid consumption may reduce the risk of dementia, new study shows

16 hours ago

Research IDs likely culprit that turns Klebsiella pneumoniae into a devastating, drug-resistant killer

Breastfeeding is crucial to shaping infant's microbes and promoting lung health, study shows

Let us know if there is a problem with our content.

Use this form if you have come across a typo, inaccuracy or would like to send an edit request for the content on this page. For general inquiries, please use our contact form . For general feedback, use the public comments section below (please adhere to guidelines ).

Please select the most appropriate category to facilitate processing of your request

Thank you for taking time to provide your feedback to the editors.

Your feedback is important to us. However, we do not guarantee individual replies due to the high volume of messages.

E-mail the story

Your email address is used only to let the recipient know who sent the email. Neither your address nor the recipient's address will be used for any other purpose. The information you enter will appear in your e-mail message and is not retained by Medical Xpress in any form.

Newsletter sign up

Get weekly and/or daily updates delivered to your inbox. You can unsubscribe at any time and we'll never share your details to third parties.

More information Privacy policy

Donate and enjoy an ad-free experience

We keep our content available to everyone. Consider supporting Science X's mission by getting a premium account.

E-mail newsletter