This table displays the results of . The information is grouped by Occupations (appearing as row headers), Low exposure, High exposure, low complementarity and High exposure, high complementarity, calculated using percentage of employees units of measure (appearing as column headers). Occupations High exposure, low complementarity High exposure, high complementarity Low exposure percentage of employees
Chart 1 end
At least three-quarters of employees in the following occupations were in the first group ( i.e. , highly exposed to AI -related job transformation and whose tasks could be replaceable with AI in the future): administrative occupations in finance, insurance and business; office support and co-ordination occupations; sales representatives and salespersons in wholesale and retail trade; service representatives and other customer and personal services occupations; professional occupations in business and finance; and computer and information systems professionals. Interestingly, among the 28 occupations, computer and information systems professionals experienced the highest growth (39%) from May 2016 to May 2021. However, this does not necessarily mean that computer and information systems professionals will be in less demand in the future because of AI . While these professionals may be in high-exposure, low-complementarity jobs, they are integral to maintaining and improving the underlying AI infrastructure, and this may lead to the creation of new tasks or jobs. Around 85% of employees or more in management occupations, professional occupations in education services and professional occupations in health (except nursing), as well as engineers, were in the second group ( i.e. , potentially highly exposed to AI -related job transformation, but AI can complement human labour as long as the worker possesses the necessary skills). Some occupations that could be less susceptible to AI -related job transformation (third group) were support occupations in sales and service; trades helpers, construction labourers and related occupations; assisting occupations in support of health services; and natural resources, agriculture and related production occupations.
Chart 2 shows the AI exposure distribution by industry based on the North American Industry Classification System 2017, at the two-digit level. More than half of employees in the following industries were in high-exposure, low-complementarity jobs: professional, scientific and technical services; finance and insurance; and information and cultural industries. In contrast, educational services, and health care and social assistance employed proportionately more employees who may be beneficiaries of AI . Within the health care and social assistance industry, it is mostly the professional occupations ( e.g. , nurses, physicians) that may be complementary with AI technologies (Figure 1). Employees in industries such as accommodation and food services, manufacturing, construction, and transportation and warehousing may face relatively lower exposure to AI -related job transformation.
Chart 2 start
Industries | High exposure, low complementarity | High exposure, high complementarity | Low exposure |
---|---|---|---|
percentage of employees | |||
The sample consists of employees aged 18 to 64 living off reserve in private dwellings, excluding full-time members of the Canadian Armed Forces. The industry classifications are based on the North American Industry Classification System 2017. The industries are ranked according to the number of employees from most (top) to least (bottom). The artificial intelligence occupational exposure index and potential complementarity are computed using Occupational Information Network data and are based on Felten, Raj and Seamans (2021) and Pizzinelli et al. (2023). Statistics Canada, Census of Population, 2021; and Occupational Information Network version 28.2. | |||
Health care and social assistance | 23 | 38 | 39 |
Retail trade | 37 | 23 | 40 |
Manufacturing | 16 | 20 | 64 |
Educational services | 23 | 69 | 8 |
Professional, scientific and technical services | 57 | 35 | 8 |
Public administration | 45 | 31 | 24 |
Construction | 13 | 14 | 73 |
Transportation and warehousing | 19 | 15 | 66 |
Accommodation and food services | 7 | 4 | 89 |
Finance and insurance | 68 | 30 | 2 |
Administrative and support, waste management and remediation services | 39 | 14 | 47 |
Wholesale trade | 33 | 33 | 34 |
Other services (except public administration) | 26 | 21 | 53 |
Information and cultural industries | 56 | 32 | 12 |
Mining, quarrying, and oil and gas extraction | 16 | 25 | 59 |
Agriculture, forestry, fishing and hunting | 12 | 10 | 78 |
Real estate and rental and leasing | 36 | 42 | 22 |
Arts, entertainment and recreation | 25 | 29 | 46 |
Utilities | 26 | 34 | 40 |
Management of companies and enterprises | 59 | 36 | 5 |
Chart 2 end
Employees in larger enterprises (in the commercial sector) may face relatively higher exposure to AI -related job transformation (Chart 3), compared with their counterparts in smaller enterprises. Roughly over one-third of workers in enterprises with 500 or more employees were in high-exposure, low-complementarity jobs in May 2016. This compares with 25% to 28% of workers in smaller enterprises. However, employees in larger enterprises were somewhat more likely to be in jobs complementary with AI than their counterparts in smaller enterprises.
Chart 3 start
Enterprise size | High exposure, high complementarity | High exposure, low complementarity | Low exposure |
---|---|---|---|
percentage of employees | |||
The sample consists of employees aged 18 to 64 living off reserve in private dwellings, excluding full-time members of the Canadian Armed Forces. The artificial intelligence occupational exposure index and potential complementarity are computed using Occupational Information Network data and are based on Felten, Raj and Seamans (2021) and Pizzinelli et al. (2023). The number of employees within an enterprise was computed by integrating Census of Population data with the Longitudinal Worker File. The commercial sector excludes employees from public administration, educational services, and health care and social assistance. Other industries which were excluded: monetary authorities - central bank; religious, grant-making, civic, and professional and similar organizations; and private households. Statistics Canada, Census of Population, 2016, and Longitudinal Worker File, 2015 and 2016; and Occupational Information Network version 28.2. | |||
500 or more employees | 23 | 36 | 41 |
100 to 499 employees | 21 | 28 | 51 |
20 to 99 employees | 19 | 25 | 56 |
Fewer than 20 employees | 18 | 28 | 54 |
Chart 3 end
Educational attainment has historically been one of the most important indicators of whether a worker will be resilient to technological shocks. The growing consensus from the labour economics literature is that less educated workers face a higher risk of automation-related job transformation than highly educated workers because the former group is more likely to perform routine and manual tasks that are more susceptible to being automated. However, Chart 4 shows that AI could affect a broader segment of the labour force than previously thought because it has the capacity to perform non-routine and cognitive tasks. Highly educated employees may face higher exposure to AI -related job transformation, as was shown in Figure 1. The highest shares of high-exposure, low-complementarity jobs are held by employees with a bachelor’s degree (37%) or a college, CEGEP or other certificate or diploma below a bachelor’s degree (36%), followed by those with a graduate degree (32%), high school or less education (25%), and an apprenticeship or trades certificate or diploma (15%). However, employees with a bachelor’s degree or higher were more likely to hold jobs that may be highly complementary with AI than those with an education below the bachelor’s degree level, as long as the potential beneficiaries of AI possess the necessary skills. Employees with an apprenticeship or trades certificate or diploma may be less exposed to AI -related job transformation, as 73% were in low-exposure occupations. However, as previously mentioned, a more nuanced view is that while less educated workers may face potentially lower exposure to AI -related job transformation, highly educated workers from high-exposure jobs may transition to low-exposure jobs, displacing less educated workers (see, e.g. , Beaudry, Green and Sand [2016]).
Chart 4 start
Highest level of education | High exposure, low complementarity | High exposure, high complementarity | Low exposure |
---|---|---|---|
percentage of employees | |||
The sample consists of employees aged 18 to 64 living off reserve in private dwellings, excluding full-time members of the Canadian Armed Forces. The artificial intelligence occupational exposure index and potential complementarity are computed using Occupational Information Network data and are based on Felten, Raj and Seamans (2021) and Pizzinelli et al. (2023). Statistics Canada, Census of Population, 2021; and Occupational Information Network version 28.2. | |||
High school or less | 25 | 13 | 62 |
Apprenticeship or trades certificate or diploma | 15 | 12 | 73 |
College, CEGEP or other certificate or diploma below bachelor's degree | 36 | 26 | 38 |
Bachelor's degree | 37 | 46 | 17 |
Graduate degree | 32 | 58 | 10 |
Chart 4 end
Many of the results presented so far are contrary to the findings on automation documented in the labour economics literature over the past two decades, raising concerns about the nexus of automation and AI . Frenette and Frank (2020) estimated that around 1/10 of employees in Canada were at high risk (probability of 70% or more) of automation-related job transformation in 2016. Chart 5 suggests that exposure to AI -related job transformation decreases as the risk of automation-related job transformation increases. The majority of employees (60%) in jobs at high risk of automation-related transformation were in jobs that may be least exposed to AI -related transformation (Chart 5). In contrast, 18% of employees in jobs at low risk (probability of less than 50%) of automation were in low-exposure jobs. However, although potentially highly exposed to AI -related job transformation, employees at a lower risk of automation-related job transformation hold jobs that could be highly complementary with AI . Jobs facing a moderate risk (probability of 50% to less than 70%) of automation-related transformation were most likely to be high-exposure, low-complementarity jobs. These findings are important, as they suggest that the distinction between manual and cognitive tasks and between repetitive and non-repetitive tasks used in the last two decades in labour economics to understand automation-related technological transformation may not apply to AI .
Chart 5 start
Risk of automation | High exposure, high complementarity | High exposure, low complementarity | Low exposure |
---|---|---|---|
percentage of employees | |||
The sample consists of employees aged 18 to 64 from the database used by Frenette and Frank (2020). Occupations at low risk of automation are those with a probability of automation lower than 50%. Occupations with a moderate risk of automation are those with a probability of automation of 50% to less than 70%. Occupations at high risk of automation are those with a probability of automation of 70% or more. The artificial intelligence occupational exposure index and potential complementarity are computed using Occupational Information Network data and are based on Felten, Raj and Seamans (2021) and Pizzinelli et al. (2023). Statistics Canada, Longitudinal and International Survey of Adults, 2016 (wave 3); and Occupational Information Network version 28.2. | |||
High risk of automation | 6 | 34 | 60 |
Moderate risk of automation | 19 | 41 | 40 |
Low risk of automation | 46 | 36 | 18 |
Chart 5 end
Like previous waves of technological transformation, AI has the potential to boost productivity. But this process can also exacerbate earnings inequality. Chart 6 shows the AI exposure distribution across employment income deciles. More than half of the jobs in the bottom half of the distribution were low-exposure jobs, while around 30% were high-exposure, low-complementarity jobs. The middle of the distribution may be the most vulnerable to AI -related job transformation, with around one-third of jobs being high exposure and low complementarity. Exposure to AI -related job transformation increases with employment income, but higher earners hold jobs that may be highly complementary with AI . Although the top decile had the highest share of jobs potentially exposed to AI -related job transformation, they also had the highest share of jobs (55%) that are highly complementary with AI . If higher earners can take advantage of the complementary benefits of AI , their productivity and earnings growth may outpace those of lower earners, and this could exacerbate earnings inequality (Cazzaniga et al. , 2024). However, the diffusion of AI could also potentially reduce earnings inequality if AI happens to adversely affect high-skill occupations (see, e.g. , Webb [2020]).
Chart 6 start
Employment income decile | High exposure, low complementarity | High exposure, high complementarity | Low exposure |
---|---|---|---|
percentage of employees | |||
The sample consists of employees aged 18 to 64 living off reserve in private dwellings, excluding full-time members of the Canadian Armed Forces. The artificial intelligence occupational exposure index and potential complementarity are computed using Occupational Information Network data and are based on Felten, Raj and Seamans (2021) and Pizzinelli et al. (2023). Statistics Canada, Census of Population, 2021; and Occupational Information Network version 28.2. | |||
Decile 1 | 32 | 16 | 52 |
Decile 2 | 31 | 15 | 54 |
Decile 3 | 29 | 17 | 54 |
Decile 4 | 31 | 19 | 50 |
Decile 5 | 35 | 21 | 44 |
Decile 6 | 35 | 24 | 41 |
Decile 7 | 33 | 31 | 36 |
Decile 8 | 29 | 41 | 30 |
Decile 9 | 26 | 50 | 24 |
Decile 10 | 26 | 55 | 19 |
Chart 6 end
Canada’s record population growth, recently driven by international migration, raises questions about the future of jobs done by immigrants and non-permanent residents. In May 2016, recent immigrants (those who landed from 2011 to 2016) (29%) were just as likely as Canadian-born individuals (29%) to be in high-exposure, low-complementarity jobs (Chart 7). However, by May 2021, while the share of Canadian-born individuals in such jobs remained the same, the share of recent immigrants (those who landed from 2016 to 2021) in these jobs increased to 37%. This was partly driven by the fact that nearly 1/10 of permanent residents who landed from 2016 to 2021 were employed in computer and information systems professions in May 2021—occupations more likely to be high exposure and low complementarity. Less than 5% of permanent residents who landed from 2011 to 2016 were employed in these professions in May 2016. This increasing concentration of recent immigrants in computer and information systems professions has been documented by Picot and Mehdi (forthcoming). Another reason could be the (temporarily) falling share of employment in occupations adversely affected by the COVID-19 pandemic. Non-permanent residents were more likely to be in high-exposure, low-complementarity jobs and low-exposure jobs than Canadian-born individuals. One goal of economic immigration programs is to fill labour and skills shortages. However, perceived labour shortages may eventually incentivize some employers to adopt AI technologies, especially if such shortages are in occupations highly exposed to AI -related job transformation.
Chart 7 start
Immigrant status | High exposure, low complementarity | High exposure, high complementarity | Low exposure |
---|---|---|---|
percentage of employees | |||
The sample consists of employees aged 18 to 64 living off reserve in private dwellings, excluding full-time members of the Canadian Armed Forces. The artificial intelligence occupational exposure index and potential complementarity are based on Felten, Raj and Seamans (2021) and Pizzinelli et al. (2023). Recent immigrants employed in May 2016 are permanent residents who landed in Canada from January 2011 to May 2016. Recent immigrants employed in May 2021 are permanent residents who landed in Canada from January 2016 to May 2021. Statistics Canada, Census of Population, 2016 and 2021; and Occupational Information Network version 28.2. | |||
Canadian-born individuals | |||
May 2016 | 29 | 28 | 43 |
May 2021 | 29 | 30 | 41 |
Recent immigrants | |||
May 2016 | 29 | 19 | 52 |
May 2021 | 37 | 23 | 40 |
Non-permanent residents | |||
May 2016 | 33 | 21 | 46 |
May 2021 | 35 | 17 | 48 |
Chart 7 end
Appendix Table A.1 (May 2016) and Appendix Table A.2 (May 2021) provide further results disaggregated by field of study, age group, gender, activity limitation status, selected census metropolitan area (CMA), racialized group, full-time or part-time status, union membership status, and whether the job can be done from home.
Exposure to AI -related job transformation varies substantially not only across fields of study but also on whether the employee has a bachelor’s degree or higher education. For example, employees who studied engineering and engineering technology or health care at a level below a bachelor’s degree were less likely to face AI -related job transformation than employees who studied the same disciplines at the bachelors’ degree or higher level. However, even with increased exposure, the majority of the latter group held jobs that were highly complementary with AI . Close to 60% of employees or more who studied mathematics and computer and information sciences—regardless of where they received their postsecondary education—were in high-exposure, low-complementarity jobs. Employees who studied construction trades and mechanic and repair trades may face relatively lower exposure to AI -related job transformation.
Employees aged 18 to 24 are overrepresented in low-exposure occupations, likely because they do not yet have the necessary experience to be employed in high-skill occupations. Core working-age employees, those aged 25 to 54 years, are generally more likely to hold jobs highly exposed to AI -related job transformation than their younger and older counterparts. But core working-age employees are also more likely to hold jobs that may be highly complementary with AI .
Slightly over one-fifth of men are employed in high-exposure, low-complementarity jobs, compared with 38% of women. This is because men are more likely to be employed in the skilled trades, which may face relatively lower exposure to AI -related job transformation. However, women (33%) are more likely than men (25%) to be employed in occupations that could be highly complementary with AI .
Occupations facing AI -related job transformation are more likely to be in large population centres. The CMAs of Ottawa–Gatineau (39%) and Toronto (37%) had proportionately more high-exposure, low-complementarity employment relative to other CMAs. But urban areas also had proportionately more jobs that could be highly complementary with AI .
Chinese (45%) and South Asian (38%) employees are more likely to hold high-exposure, low-complementarity jobs than other racialized groups. This is partly driven by their relatively higher representation in computer and information systems professions, which potentially highly exposed to AI -related job transformation and whose tasks may be replaceable by AI in the future. However, as noted earlier, these occupations could be integral to maintaining and improving the underlying AI infrastructure.
Unionized employees are almost as likely as their non-unionized counterparts to be highly exposed to AI -related job transformation. However, non-unionized employees (35%) are more likely to be in high-exposure, low-complementarity jobs than unionized employees (23%). This was largely driven by a higher share of unionized employees in health care and education occupations, which are potentially highly exposed to and complementary with AI .
The COVID-19 pandemic has led to significant increases in working from home (see, e.g. , Mehdi and Morissette [2021a] or Mehdi and Morissette [2021b]). These jobs are usually held by highly educated employees who may be more exposed to AI -related job transformation than their less educated counterparts. Just over half (51%) of employees with jobs that can be done from home were in high-exposure, low-complementarity occupations, compared with 14% of employees in jobs that cannot be done from home. Note However, 47% of the former group holds jobs that could be highly complementary with AI , compared with 14% of the latter group. How the advent of AI could affect the labour market in potential future pandemics is unclear (see, e.g. , Frenette and Morissette [2021]).
This study provides experimental estimates of the number and percentage of employees aged 18 to 64 in Canada potentially susceptible to AI -related job transformation using the C-AIOE index of Pizzinelli et al. (2023) and data from O*NET and the 2016 and 2021 censuses of population. Occupations were grouped into three distinct categories: (1) high exposure and low complementarity, (2) high exposure and high complementarity, and (3) low exposure. Being in the second group does not necessarily reduce AIOE , as workers would still need the necessary skills to be able to leverage the potential complementary benefits of AI .
On average, in May 2021, approximately 4.2 million employees (31%) in Canada were in the first group, about 3.9 million (29%) were in the second group and about 5.4 million (40%) were in the third group. This distribution was similar in May 2016. Employees in the following industries were more likely than others to be in the first group: professional, scientific and technical services; finance and insurance; and information and cultural industries. In contrast, employees in educational services, and health care and social assistance were more likely to be in the second group than other employees. Employees in industries such as accommodation and food services, manufacturing, construction, and transportation and warehousing face relatively less exposure to AI -related job transformation.
Unlike previous waves of automation, which affected routine and non-cognitive jobs, AI could affect a broader segment of the labour force than previously thought. Contrary to previous findings from the technological transformation literature, AI could transform the jobs of highly educated employees to a greater extent than those of their less educated counterparts. However, highly educated employees also hold jobs that may be highly complementary with AI . Previous labour market policy recommendations in response to the threat of automation included supporting upskilling and job transition initiatives. The findings in this article, which reflect the possible role of AI exposure and complementarity for occupations and workers in Canada, may inform future policy discussions on the topic.
The index used in this study is subjective and based on judgments regarding some current possibilities of AI . Consequently, the applicability of the index may decrease over time as AI capabilities grow and AI can perform an increasing number of tasks currently done by human workers. The index is also computed at the occupational level, implicitly assuming that tasks within a given occupation are the same across regions and worker characteristics. However, the ability to adapt and respond to changing skill demands will likely vary across worker characteristics. If tasks vary substantially across regions and worker characteristics, and if some tasks are more vulnerable to AI substitution, the index could be over- or underestimated to a certain extent. For example, computer programmers in one region who spend their work day coding may be more susceptible to AI -related job transformation if AI is proficient in writing that code. In contrast, programmers in another region who spend part of their day interacting face to face with team members may be less susceptible, assuming AI is not yet proficient in face-to-face interactions. To address this, future research could develop alternative measures of AI exposure at the worker level, similar to how Arntz, Gregory and Zierahn (2016) or Frenette and Frank (2020) estimated automation risk. Future studies could also attempt to answer the question, “What happened to workers whose jobs were exposed to AI -related job transformation?”
As AI technologies continue to evolve, they have the potential to reshape industries, redefine job roles and transform the nature of work. AI may also create new challenges and divides and push boundaries. But large-scale AI adoption may take some time, as employers may face financial, legal and institutional constraints. This study provides a static picture of AIOE based on employment compositions in Canada in May 2016 and May 2021, which were fairly similar. How AI affects productivity and how workers and firms adapt to the potentially evolving labour market in the long run remain to be seen.
Employment | AIOE | Potential complementarity | Complementarity-adjusted AIOE | High exposure, low complementarity | High exposure, high complementarity | Low exposure | |
---|---|---|---|---|---|---|---|
number | average index | percent | |||||
... not applicable 11 referrer 22 referrer 33 referrer AIOE = artificial intelligence occupational exposure and n.i.e. = not included elsewhere. The sample consists of employees aged 18 to 64 living off reserve in private dwellings, excluding full-time members of the Canadian Armed Forces. The numbers in parentheses indicate the codes from version 1.3 of the National Occupational Classification (NOC) 2016. Of the 500 NOC occupations, 10 occupations, which represented less than 1% of Canadian employment, were excluded because of a lack of Occupational Information Network (O*NET) data for computing the AIOE or complementarity parameter. The AIOE index and potential complementarity are computed using O*NET data and are based on Felten, Raj and Seamans (2021) and Pizzinelli et al. (2023). The complementarity-adjusted AIOE is calculated using a weight of 1. An occupation is “high exposure” if its AIOE exceeds the median AIOE across all occupations (around 6.0) and “low exposure” otherwise. An occupation is “high complementarity” if its complementarity level exceeds the median complementarity level across all occupations (around 0.6) and “low complementarity” otherwise. Numbers may not sum up to the total because of rounding or non-responses.Statistics Canada, Census of Population, 2016, Longitudinal and International Study of Adults (wave 3), 2016, and Longitudinal Worker File, 2015 and 2016; and Occupational Information Network version 28.2. | |||||||
Total | 13,943,200 | 6.0758 | 0.5953 | 5.3231 | 30 | 27 | 43 |
Occupation | |||||||
Management occupations (0) | 1,401,800 | 6.4705 | 0.6610 | 5.4581 | 6 | 86 | 8 |
Support occupations in sales and service (66, 67) | 1,156,000 | 5.5916 | 0.5097 | 5.1406 | 2 | 0 | 98 |
Administrative occupations in finance, insurance and business (12, 13) | 961,000 | 6.4815 | 0.5578 | 5.8056 | 83 | 17 | 0 |
Office support and co-ordination occupations (14, 15) | 916,800 | 6.2339 | 0.5002 | 5.7637 | 79 | 1 | 20 |
Sales and service supervisors (62, 63) | 759,000 | 6.0866 | 0.6040 | 5.3035 | 17 | 30 | 53 |
Service representatives and other customer and personal services occupations (65) | 744,800 | 6.0972 | 0.5345 | 5.5326 | 59 | 3 | 38 |
Transport and heavy equipment operators and servicers (74, 75) | 701,400 | 5.5456 | 0.6080 | 4.8267 | 0 | 0 | 100 |
Industrial, electrical and construction trades (72) | 646,100 | 5.5706 | 0.6345 | 4.7715 | 0 | 0 | 100 |
Professional occupations in education services (40) | 643,900 | 6.4743 | 0.6814 | 5.3975 | 9 | 91 | 0 |
Support occupations in law and social services (42, 43, 44) | 624,100 | 6.0716 | 0.6286 | 5.2256 | 27 | 30 | 43 |
Sales representatives and salespersons in wholesale and retail trade (64) | 618,600 | 6.0941 | 0.5568 | 5.4565 | 85 | 15 | 0 |
Technical occupations related to natural and applied sciences (22) | 460,200 | 6.1608 | 0.6202 | 5.3268 | 36 | 37 | 27 |
Professional occupations in business and finance (11) | 452,100 | 6.6595 | 0.5886 | 5.8600 | 100 | 0 | 0 |
Maintenance and equipment operation trades (73) | 418,400 | 5.6468 | 0.6590 | 4.7689 | 0 | 6 | 94 |
Assemblers and labourers in manufacturing and utilities (95, 96) | 371,800 | 5.5876 | 0.5226 | 5.0988 | 0 | 0 | 100 |
Professional occupations in law and social, community and government services (41) | 364,000 | 6.5632 | 0.6446 | 5.5925 | 22 | 78 | 0 |
Machine operators and supervisors in manufacturing and utilities (92, 94) | 334,100 | 5.7241 | 0.5783 | 5.0586 | 0 | 8 | 92 |
Occupations in art, culture, recreation and sports (51, 52) | 311,500 | 6.0360 | 0.6035 | 5.2657 | 38 | 28 | 34 |
Computer and information systems professionals (217) | 307,600 | 6.5877 | 0.5513 | 5.9195 | 100 | 0 | 0 |
Assisting occupations in support of health services (34) | 294,500 | 5.6644 | 0.6101 | 4.9240 | 0 | 0 | 100 |
Technical occupations in health (32) | 292,600 | 5.8853 | 0.6244 | 5.0736 | 14 | 17 | 69 |
Professional occupations in nursing (30) | 289,000 | 6.1660 | 0.6995 | 5.0834 | 0 | 100 | 0 |
Natural resources, agriculture and related production occupations (8) | 246,000 | 5.4174 | 0.5742 | 4.7974 | 0 | 0 | 100 |
Engineers (213, 214) | 203,900 | 6.5441 | 0.6337 | 5.6093 | 13 | 87 | 0 |
Trades helpers, construction labourers and related occupations (76) | 174,700 | 5.3877 | 0.6018 | 4.7027 | 0 | 0 | 100 |
Professional occupations in health (except nursing) (31) | 155,100 | 6.3060 | 0.7283 | 5.1119 | 0 | 87 | 13 |
Physical and life science professionals (211, 212) | 53,500 | 6.3801 | 0.6588 | 5.3913 | 2 | 98 | 0 |
Architects and statisticians (215, 216) | 41,000 | 6.5368 | 0.6374 | 5.5940 | 29 | 71 | 0 |
Industry | |||||||
Health care and social assistance | 1,757,800 | 6.0723 | 0.6166 | 5.2559 | 22 | 39 | 39 |
Retail trade | 1,659,300 | 6.0276 | 0.5654 | 5.3706 | 41 | 22 | 37 |
Manufacturing | 1,379,800 | 5.9026 | 0.5773 | 5.2217 | 16 | 18 | 66 |
Educational services | 1,060,100 | 6.3636 | 0.6512 | 5.3987 | 22 | 69 | 9 |
Accommodation and food services | 974,600 | 5.7522 | 0.5456 | 5.1790 | 7 | 3 | 90 |
Public administration | 966,600 | 6.2384 | 0.6106 | 5.4253 | 43 | 26 | 31 |
Professional, scientific and technical services | 892,700 | 6.4498 | 0.5881 | 5.6769 | 58 | 34 | 8 |
Construction | 892,500 | 5.7784 | 0.6390 | 4.9378 | 13 | 14 | 73 |
Finance and insurance | 672,900 | 6.5370 | 0.5806 | 5.7765 | 70 | 28 | 2 |
Transportation and warehousing | 663,500 | 5.8835 | 0.5975 | 5.1514 | 20 | 15 | 65 |
Wholesale trade | 557,900 | 6.1445 | 0.5926 | 5.3922 | 30 | 35 | 35 |
Other services (except public administration) | 551,600 | 5.9888 | 0.5961 | 5.2458 | 23 | 18 | 59 |
Administrative and support, waste management and remediation services | 549,800 | 5.9322 | 0.5568 | 5.3101 | 40 | 12 | 48 |
Information and cultural industries | 348,000 | 6.2984 | 0.5908 | 5.5354 | 52 | 32 | 16 |
Arts, entertainment and recreation | 238,700 | 5.9661 | 0.5830 | 5.2643 | 28 | 21 | 51 |
Real estate and rental and leasing | 220,400 | 6.2789 | 0.6129 | 5.4460 | 31 | 47 | 22 |
Mining, quarrying, and oil and gas extraction | 212,400 | 5.9766 | 0.6346 | 5.1229 | 18 | 26 | 56 |
Agriculture, forestry, fishing and hunting | 196,000 | 5.6807 | 0.5810 | 5.0137 | 10 | 9 | 81 |
Utilities | 124,500 | 6.1459 | 0.6279 | 5.2915 | 28 | 34 | 38 |
Management of companies and enterprises | 24,200 | 6.4615 | 0.5929 | 5.6708 | 55 | 39 | 6 |
Highest level of education | |||||||
High school or less | 4,751,200 | 5.8867 | 0.5692 | 5.2349 | 26 | 13 | 61 |
Apprenticeship or trades certificate or diploma | 1,450,400 | 5.8141 | 0.6052 | 5.0680 | 15 | 12 | 73 |
College, CEGEP or other certificate or diploma below bachelor's degree | 3,679,500 | 6.1146 | 0.5944 | 5.3629 | 36 | 26 | 38 |
Bachelor's degree | 2,800,700 | 6.3249 | 0.6162 | 5.4764 | 36 | 47 | 17 |
Graduate degree | 1,261,400 | 6.4227 | 0.6380 | 5.4918 | 29 | 61 | 10 |
Employment income decile | |||||||
Decile 1 | 1,394,320 | 5.9443 | 0.5650 | 5.2964 | 30 | 15 | 55 |
Decile 2 | 1,394,320 | 5.9160 | 0.5602 | 5.2867 | 30 | 13 | 57 |
Decile 3 | 1,394,320 | 5.9337 | 0.5679 | 5.2797 | 29 | 15 | 56 |
Decile 4 | 1,394,320 | 5.9766 | 0.5764 | 5.2935 | 30 | 18 | 52 |
Decile 5 | 1,394,320 | 6.0313 | 0.5810 | 5.3292 | 34 | 20 | 46 |
Decile 6 | 1,394,320 | 6.0885 | 0.5898 | 5.3543 | 36 | 23 | 41 |
Decile 7 | 1,394,320 | 6.1279 | 0.6028 | 5.3491 | 34 | 28 | 38 |
Decile 8 | 1,394,320 | 6.1767 | 0.6221 | 5.3317 | 29 | 38 | 33 |
Decile 9 | 1,394,320 | 6.2370 | 0.6389 | 5.3320 | 25 | 48 | 27 |
Decile 10 | 1,394,320 | 6.3204 | 0.6474 | 5.3769 | 23 | 54 | 23 |
Selected census metropolitan area | |||||||
Toronto | 2,431,000 | 6.1519 | 0.5921 | 5.3990 | 35 | 29 | 36 |
Montréal | 1,683,900 | 6.1190 | 0.5909 | 5.3740 | 33 | 29 | 38 |
Vancouver | 1,029,800 | 6.1123 | 0.5946 | 5.3573 | 33 | 28 | 39 |
Calgary | 614,000 | 6.1265 | 0.5998 | 5.3537 | 32 | 30 | 38 |
Ottawa–Gatineau | 582,000 | 6.1996 | 0.5959 | 5.4301 | 38 | 32 | 30 |
Edmonton | 577,900 | 6.0656 | 0.6011 | 5.2972 | 29 | 27 | 44 |
Québec | 352,100 | 6.1292 | 0.5937 | 5.3749 | 34 | 29 | 37 |
Winnipeg | 338,700 | 6.0764 | 0.5937 | 5.3285 | 30 | 27 | 43 |
Hamilton | 304,700 | 6.0836 | 0.5977 | 5.3218 | 28 | 30 | 42 |
Kitchener–Cambridge–Waterloo | 228,600 | 6.0757 | 0.5920 | 5.3324 | 30 | 26 | 44 |
London | 198,900 | 6.0716 | 0.5944 | 5.3214 | 29 | 27 | 44 |
Halifax | 182,300 | 6.1287 | 0.5970 | 5.3648 | 33 | 29 | 38 |
Other | 5,419,300 | ... not applicable | ... not applicable | ... not applicable | ... not applicable | ... not applicable | ... not applicable |
Field of study based on highest level of education | |||||||
High school or less | 4,751,200 | 5.8867 | 0.5692 | 5.2349 | 26 | 13 | 61 |
Some postsecondary below bachelor's degree | 5,129,900 | 6.0296 | 0.5975 | 4.5294 | 30 | 22 | 48 |
Business and administration | 1,075,300 | 6.3026 | 0.5687 | 5.6073 | 56 | 24 | 20 |
Trades (except construction trades and mechanic and repair technologies/technicians), services, natural resources and conservation | 991,900 | 5.8747 | 0.5952 | 5.1478 | 19 | 13 | 68 |
Construction trades and mechanic and repair technologies/technicians | 786,800 | 5.7282 | 0.6422 | 4.8855 | 6 | 12 | 82 |
Health care | 784,900 | 5.9741 | 0.6062 | 5.2041 | 21 | 25 | 54 |
Engineering and engineering technology | 407,100 | 6.0475 | 0.6157 | 5.2382 | 23 | 30 | 47 |
Arts and humanities | 330,400 | 6.0925 | 0.5743 | 5.4013 | 41 | 22 | 37 |
Social and behavioural sciences | 269,800 | 6.1189 | 0.5953 | 5.3615 | 30 | 43 | 27 |
Mathematics and computer and information sciences | 216,700 | 6.2733 | 0.5750 | 5.5625 | 56 | 20 | 24 |
Science and science technology | 109,500 | 6.0495 | 0.5926 | 5.3087 | 34 | 23 | 43 |
Legal professions and studies | 80,300 | 6.3578 | 0.5435 | 5.7395 | 72 | 12 | 16 |
Education and teaching | 77,200 | 6.1270 | 0.6225 | 5.2851 | 23 | 52 | 25 |
Bachelor's degree or higher | 4,062,100 | 6.3552 | 0.6230 | 4.6072 | 34 | 52 | 14 |
Business and administration | 797,100 | 6.4447 | 0.5981 | 5.6386 | 52 | 36 | 12 |
Social and behavioural sciences | 619,900 | 6.3561 | 0.6069 | 5.5332 | 42 | 42 | 16 |
Education and teaching | 474,100 | 6.3763 | 0.6719 | 5.3417 | 10 | 84 | 6 |
Arts and humanities | 443,300 | 6.2917 | 0.6047 | 5.4812 | 39 | 42 | 19 |
Engineering and engineering technology | 430,000 | 6.3772 | 0.6196 | 5.5103 | 29 | 56 | 15 |
Health care | 397,200 | 6.1986 | 0.6758 | 5.1821 | 8 | 74 | 18 |
Science and science technology | 384,900 | 6.2881 | 0.6220 | 5.4261 | 30 | 50 | 20 |
Mathematics and computer and information sciences | 217,400 | 6.4472 | 0.5813 | 5.6964 | 66 | 24 | 10 |
Trades (except construction trades and mechanic and repair technologies/technicians), services, natural resources and conservation | 211,500 | 6.3228 | 0.6330 | 5.4205 | 24 | 59 | 17 |
Legal professions and studies | 86,700 | 6.4908 | 0.6510 | 5.5042 | 24 | 67 | 9 |
Construction trades and mechanic and repair technologies/technicians | 0 | .. not available for a specific reference period | .. not available for a specific reference period | .. not available for a specific reference period | .. not available for a specific reference period | .. not available for a specific reference period | .. not available for a specific reference period |
Age | |||||||
18 to 24 years | 1,818,200 | 5.8816 | 0.5621 | 5.2522 | 30 | 10 | 60 |
25 to 34 years | 3,247,300 | 6.0952 | 0.6008 | 5.3245 | 31 | 28 | 41 |
35 to 44 years | 3,160,700 | 6.1342 | 0.6055 | 5.3435 | 30 | 33 | 37 |
45 to 54 years | 3,351,000 | 6.1096 | 0.6001 | 5.3378 | 29 | 31 | 40 |
55 to 64 years | 2,366,000 | 6.0725 | 0.5927 | 5.3273 | 30 | 27 | 43 |
Gender | |||||||
Men | 6,997,800 | 5.9826 | 0.6079 | 5.2034 | 22 | 24 | 54 |
Women | 6,945,400 | 6.1697 | 0.5826 | 5.4437 | 38 | 30 | 32 |
Often or always have difficulties with daily activities | |||||||
No | 12,242,500 | 6.0779 | 0.5961 | 5.3223 | 30 | 28 | 42 |
Yes | 1,650,500 | 6.0655 | 0.5894 | 5.3319 | 31 | 25 | 44 |
Immigrant status | |||||||
Canadian-born individual | 10,465,100 | 6.0753 | 0.5985 | 5.3133 | 29 | 28 | 43 |
Permanent resident (landed before 2006) | 2,222,300 | 6.1044 | 0.5894 | 5.3653 | 32 | 27 | 41 |
Permanent resident (landed from 2006 to 2010) | 513,000 | 6.0401 | 0.5819 | 5.3307 | 30 | 23 | 47 |
Permanent resident (landed from 2011 to 2016) | 520,600 | 6.0023 | 0.5754 | 5.3163 | 29 | 19 | 52 |
Non-permanent resident | 222,200 | 6.0661 | 0.5796 | 5.3600 | 33 | 21 | 46 |
Racialized group | |||||||
White | 10,334,600 | 6.0815 | 0.5997 | 5.3149 | 29 | 29 | 42 |
South Asian | 740,100 | 6.0995 | 0.5826 | 5.3816 | 35 | 24 | 41 |
Chinese | 577,700 | 6.2033 | 0.5831 | 5.4717 | 41 | 27 | 32 |
Black | 421,600 | 6.0114 | 0.5807 | 5.3101 | 31 | 21 | 48 |
Filipino | 415,700 | 5.9028 | 0.5705 | 5.2438 | 23 | 14 | 63 |
Arab | 158,400 | 6.1496 | 0.5933 | 5.3928 | 33 | 32 | 35 |
Latin American | 213,200 | 5.9880 | 0.5763 | 5.3011 | 29 | 20 | 51 |
Southeast Asian | 131,400 | 5.9479 | 0.5677 | 5.2912 | 25 | 15 | 60 |
West Asian | 95,700 | 6.1382 | 0.5902 | 5.3922 | 34 | 29 | 37 |
Korean | 64,200 | 6.1347 | 0.5896 | 5.3898 | 32 | 29 | 39 |
Japanese | 24,700 | 6.1799 | 0.5936 | 5.4189 | 35 | 32 | 33 |
Racialized groups, n.i.e. | 57,800 | 6.0614 | 0.5816 | 5.3522 | 33 | 23 | 44 |
Multiple racialized groups | 247,000 | 6.1092 | 0.5863 | 5.3789 | 35 | 26 | 39 |
Hours worked per week | |||||||
30 or more (full-time) | 11,264,800 | 6.1030 | 0.6025 | 5.3256 | 29 | 30 | 41 |
Less than 30, but more than 0 (part-time) | 2,346,600 | 5.9624 | 0.5644 | 5.3149 | 32 | 17 | 51 |
Union member | |||||||
No | 9,215,800 | 6.0886 | 0.5856 | 5.3637 | 34 | 24 | 42 |
Yes | 4,727,500 | 6.0508 | 0.6141 | 5.2438 | 23 | 33 | 44 |
Enterprise size 1 | |||||||
Fewer than 20 employees | 2,167,400 | 6.0170 | 0.5884 | 5.2935 | 29 | 21 | 50 |
20 to 99 employees | 2,207,100 | 5.9952 | 0.5866 | 5.2780 | 25 | 23 | 52 |
100 to 499 employees | 1,830,500 | 6.0315 | 0.5889 | 5.3030 | 28 | 24 | 48 |
500 or more employees | 6,527,400 | 6.1452 | 0.6028 | 5.3612 | 33 | 32 | 35 |
Job can be done from home 2 | |||||||
No | 8,171,400 | 5.7949 | 0.5927 | 5.0835 | 15 | 13 | 72 |
Yes | 5,771,800 | 6.4734 | 0.5989 | 5.6622 | 51 | 47 | 2 |
Risk of automation 3 | |||||||
Low risk of automation (probability of less than 50%) | 7,849,200 | 6.3341 | 0.6258 | 5.4453 | 36 | 46 | 18 |
Moderate risk of automation (probability of 50% to less than 70%) | 4,285,800 | 6.0999 | 0.5872 | 5.3709 | 41 | 19 | 40 |
High risk of automation (probability of 70% or higher) | 1,547,300 | 5.9139 | 0.5488 | 5.3215 | 34 | 6 | 60 |
Employment | AIOE | Potential complementarity | Complementarity-adjusted AIOE | High exposure, low complementarity | High exposure, high complementarity | Low exposure | |
---|---|---|---|---|---|---|---|
number | average index | percent | |||||
... not applicable 11 referrer 22 referrer AIOE = artificial intelligence occupational exposure and n.i.e. = not included elsewhere. The sample consists of employees aged 18 to 64 living off reserve in private dwellings, excluding full-time members of the Canadian Armed Forces. The numbers in parentheses indicate the codes from version 1.3 of the National Occupational Classification (NOC) 2016. Of the 500 NOC occupations, 10 occupations, which represented less than 1% of Canadian employment, were excluded because of a lack of Occupational Information Network (O*NET) data for computing the AIOE or complementarity parameter. The AIOE index and potential complementarity are computed using O*NET data and are based on Felten, Raj and Seamans (2021) and Pizzinelli et al. (2023). The complementarity-adjusted AIOE is calculated using a weight of 1. An occupation is “high exposure” if its AIOE exceeds the median AIOE across all occupations (around 6.0) and “low exposure” otherwise. An occupation is “high complementarity” if its complementarity level exceeds the median complementarity level across all occupations (around 0.6) and “low complementarity” otherwise. Numbers may not sum up to the total because of rounding or non-responses.Statistics Canada, Census of Population, 2021; and Occupational Information Network version 28.2. | |||||||
Total | 13,589,900 | 6.1010 | 0.5989 | 4.5683 | 31 | 29 | 40 |
Occupation | |||||||
Management occupations (0) | 1,500,200 | 6.4858 | 0.6599 | 4.4635 | 6 | 87 | 7 |
Support occupations in sales and service (66, 67) | 1,040,700 | 5.5812 | 0.5093 | 4.6833 | 1 | 0 | 99 |
Administrative occupations in finance, insurance and business (12, 13) | 979,700 | 6.4791 | 0.5592 | 5.1198 | 82 | 18 | 0 |
Office support and co-ordination occupations (14, 15) | 832,500 | 6.2227 | 0.5029 | 5.2678 | 76 | 0 | 24 |
Sales and service supervisors (62, 63) | 620,200 | 6.0893 | 0.6046 | 4.5206 | 19 | 27 | 54 |
Service representatives and other customer and personal services occupations (65) | 516,600 | 6.2254 | 0.5300 | 5.1038 | 77 | 2 | 21 |
Transport and heavy equipment operators and servicers (74, 75) | 702,100 | 5.5430 | 0.6095 | 4.0975 | 0 | 0 | 100 |
Industrial, electrical and construction trades (72) | 606,000 | 5.5727 | 0.6381 | 3.9541 | 0 | 0 | 100 |
Professional occupations in education services (40) | 675,000 | 6.4791 | 0.6780 | 4.3461 | 12 | 88 | 0 |
Support occupations in law and social services (42, 43, 44) | 617,400 | 6.1154 | 0.6333 | 4.3856 | 32 | 34 | 34 |
Sales representatives and salespersons in wholesale and retail trade (64) | 482,300 | 6.0790 | 0.5537 | 4.8267 | 89 | 11 | 0 |
Technical occupations related to natural and applied sciences (22) | 477,100 | 6.1674 | 0.6195 | 4.5010 | 34 | 40 | 26 |
Professional occupations in business and finance (11) | 491,600 | 6.6558 | 0.5901 | 5.0478 | 100 | 0 | 0 |
Maintenance and equipment operation trades (73) | 408,500 | 5.6534 | 0.6609 | 3.8844 | 0 | 7 | 93 |
Assemblers and labourers in manufacturing and utilities (95, 96) | 343,400 | 5.5736 | 0.5196 | 4.6156 | 0 | 0 | 100 |
Professional occupations in law and social, community and government services (41) | 406,600 | 6.5639 | 0.6414 | 4.6434 | 24 | 76 | 0 |
Machine operators and supervisors in manufacturing and utilities (92, 94) | 302,400 | 5.7288 | 0.5829 | 4.3706 | 0 | 10 | 90 |
Occupations in art, culture, recreation and sports (51, 52) | 277,500 | 6.1135 | 0.6011 | 4.5674 | 46 | 33 | 21 |
Computer and information systems professionals (217) | 426,900 | 6.5851 | 0.5516 | 5.2472 | 100 | 0 | 0 |
Assisting occupations in support of health services (34) | 374,000 | 5.6574 | 0.6095 | 4.1815 | 0 | 0 | 100 |
Technical occupations in health (32) | 309,200 | 5.8897 | 0.6250 | 4.2623 | 13 | 18 | 69 |
Professional occupations in nursing (30) | 317,500 | 6.1660 | 0.6995 | 4.0007 | 0 | 100 | 0 |
Natural resources, agriculture and related production occupations (8) | 221,300 | 5.4180 | 0.5746 | 4.1757 | 0 | 0 | 100 |
Engineers (213, 214) | 210,800 | 6.5463 | 0.6340 | 4.6747 | 13 | 87 | 0 |
Trades helpers, construction labourers and related occupations (76) | 186,800 | 5.3881 | 0.6021 | 4.0165 | 0 | 0 | 100 |
Professional occupations in health (except nursing) (31) | 153,500 | 6.2932 | 0.7266 | 3.9209 | 0 | 86 | 14 |
Physical and life science professionals (211, 212) | 59,900 | 6.3805 | 0.6591 | 4.4004 | 1 | 99 | 0 |
Architects and statisticians (215, 216) | 50,200 | 6.5470 | 0.6391 | 4.6462 | 25 | 75 | 0 |
Industry | |||||||
Health care and social assistance | 1,955,500 | 6.0762 | 0.6154 | 4.4512 | 23 | 38 | 39 |
Retail trade | 1,549,400 | 6.0176 | 0.5659 | 4.7014 | 37 | 23 | 40 |
Manufacturing | 1,295,400 | 5.9164 | 0.5795 | 4.5381 | 16 | 20 | 64 |
Educational services | 1,091,300 | 6.3759 | 0.6516 | 4.4403 | 23 | 69 | 8 |
Accommodation and food services | 663,800 | 5.7734 | 0.5548 | 4.5682 | 7 | 4 | 89 |
Public administration | 1,025,900 | 6.2976 | 0.6099 | 4.6612 | 45 | 31 | 24 |
Professional, scientific and technical services | 1,045,200 | 6.4585 | 0.5912 | 4.8910 | 57 | 35 | 8 |
Construction | 958,000 | 5.7966 | 0.6388 | 4.1124 | 13 | 14 | 73 |
Finance and insurance | 661,500 | 6.5431 | 0.5824 | 5.0093 | 68 | 30 | 2 |
Transportation and warehousing | 671,700 | 5.8772 | 0.5969 | 4.4172 | 19 | 15 | 66 |
Wholesale trade | 498,000 | 6.1463 | 0.5921 | 4.6445 | 33 | 33 | 34 |
Other services (except public administration) | 468,000 | 6.0246 | 0.6002 | 4.5052 | 26 | 21 | 53 |
Administrative and support, waste management and remediation services | 499,400 | 5.9396 | 0.5639 | 4.6524 | 39 | 14 | 47 |
Information and cultural industries | 318,100 | 6.3207 | 0.5909 | 4.7896 | 56 | 32 | 12 |
Arts, entertainment and recreation | 157,000 | 6.0105 | 0.5981 | 4.5039 | 25 | 29 | 46 |
Real estate and rental and leasing | 169,800 | 6.2870 | 0.6070 | 4.6585 | 36 | 42 | 22 |
Mining, quarrying, and oil and gas extraction | 194,600 | 5.9483 | 0.6345 | 4.2483 | 16 | 25 | 59 |
Agriculture, forestry, fishing and hunting | 192,300 | 5.7126 | 0.5830 | 4.3605 | 12 | 10 | 78 |
Utilities | 136,800 | 6.1356 | 0.6309 | 4.4107 | 26 | 34 | 40 |
Management of companies and enterprises | 38,300 | 6.5039 | 0.5938 | 4.9061 | 59 | 36 | 5 |
Highest level of education | |||||||
High school or less | 4,155,800 | 5.8823 | 0.5719 | 4.5637 | 25 | 13 | 62 |
Apprenticeship or trades certificate or diploma | 1,280,100 | 5.8122 | 0.6100 | 4.2933 | 15 | 12 | 73 |
College, CEGEP or other certificate or diploma below bachelor's degree | 3,437,800 | 6.1139 | 0.5965 | 4.5994 | 36 | 26 | 38 |
Bachelor's degree | 3,148,400 | 6.3328 | 0.6157 | 4.6383 | 37 | 46 | 17 |
Graduate degree | 1,567,800 | 6.4232 | 0.6327 | 4.5959 | 32 | 58 | 10 |
Employment income decile | |||||||
Decile 1 | 1,358,990 | 5.9766 | 0.5684 | 4.6553 | 32 | 16 | 52 |
Decile 2 | 1,358,990 | 5.9462 | 0.5651 | 4.6525 | 31 | 15 | 54 |
Decile 3 | 1,358,990 | 5.9558 | 0.5745 | 4.6049 | 29 | 17 | 54 |
Decile 4 | 1,358,990 | 5.9874 | 0.5802 | 4.5973 | 31 | 19 | 50 |
Decile 5 | 1,358,990 | 6.0515 | 0.5857 | 4.6158 | 35 | 21 | 44 |
Decile 6 | 1,358,990 | 6.1037 | 0.5948 | 4.6010 | 35 | 24 | 41 |
Decile 7 | 1,358,990 | 6.1473 | 0.6088 | 4.5477 | 33 | 31 | 36 |
Decile 8 | 1,358,990 | 6.2050 | 0.6259 | 4.4846 | 29 | 41 | 30 |
Decile 9 | 1,358,990 | 6.2724 | 0.6398 | 4.4473 | 26 | 50 | 24 |
Decile 10 | 1,358,990 | 6.3596 | 0.6447 | 4.4786 | 26 | 55 | 19 |
Selected census metropolitan area | |||||||
Toronto | 2,267,500 | 6.1981 | 0.5960 | 4.6586 | 37 | 31 | 32 |
Montréal | 1,725,500 | 6.1426 | 0.5960 | 4.6171 | 34 | 31 | 35 |
Vancouver | 1,033,200 | 6.1407 | 0.5975 | 4.6068 | 34 | 30 | 36 |
Calgary | 576,500 | 6.1420 | 0.6011 | 4.5856 | 32 | 31 | 37 |
Ottawa–Gatineau | 591,300 | 6.2361 | 0.6005 | 4.6613 | 39 | 34 | 27 |
Edmonton | 549,000 | 6.0803 | 0.6023 | 4.5328 | 29 | 29 | 42 |
Québec | 350,800 | 6.1568 | 0.6000 | 4.6043 | 34 | 31 | 35 |
Winnipeg | 338,900 | 6.0912 | 0.5939 | 4.5909 | 32 | 27 | 41 |
Hamilton | 286,900 | 6.1237 | 0.6022 | 4.5635 | 29 | 33 | 38 |
Kitchener–Cambridge–Waterloo | 229,900 | 6.1113 | 0.5953 | 4.5971 | 31 | 28 | 41 |
London | 195,800 | 6.0900 | 0.5980 | 4.5639 | 30 | 29 | 41 |
Halifax | 184,700 | 6.1574 | 0.6023 | 4.5911 | 33 | 32 | 35 |
Other | 5,259,900 | ... not applicable | ... not applicable | ... not applicable | ... not applicable | ... not applicable | ... not applicable |
Field of study based on highest level of education | |||||||
High school or less | 4,155,800 | 5.8823 | 0.5719 | 4.5637 | 25 | 13 | 62 |
Some postsecondary below bachelor's degree | 4,717,900 | 6.0321 | 0.6002 | 4.5164 | 30 | 22 | 48 |
Business and administration | 961,300 | 6.2916 | 0.5703 | 4.8946 | 55 | 23 | 22 |
Trades (except construction trades and mechanic and repair technologies/technicians), services, natural resources and conservation | 872,500 | 5.8886 | 0.5985 | 4.4130 | 21 | 14 | 65 |
Construction trades and mechanic and repair technologies/technicians | 734,100 | 5.7238 | 0.6458 | 4.0197 | 6 | 12 | 82 |
Health care | 736,600 | 5.9753 | 0.6078 | 4.4265 | 22 | 24 | 54 |
Engineering and engineering technology | 371,800 | 6.0478 | 0.6157 | 4.4294 | 23 | 30 | 47 |
Arts and humanities | 299,600 | 6.1089 | 0.5786 | 4.6975 | 42 | 23 | 35 |
Social and behavioural sciences | 256,600 | 6.1349 | 0.5981 | 4.6009 | 31 | 44 | 25 |
Mathematics and computer and information sciences | 227,600 | 6.2656 | 0.5762 | 4.8378 | 56 | 21 | 23 |
Science and science technology | 107,000 | 6.0589 | 0.5927 | 4.5756 | 34 | 23 | 43 |
Legal professions and studies | 74,600 | 6.3818 | 0.5443 | 5.1366 | 73 | 12 | 15 |
Education and teaching | 75,900 | 6.1162 | 0.6356 | 4.3581 | 21 | 58 | 21 |
Bachelor's degree or higher | 4,716,200 | 6.3628 | 0.6213 | 4.6242 | 36 | 50 | 14 |
Business and administration | 993,900 | 6.4376 | 0.5977 | 4.8297 | 52 | 36 | 12 |
Social and behavioural sciences | 679,800 | 6.3792 | 0.6085 | 4.7188 | 43 | 43 | 14 |
Education and teaching | 475,600 | 6.3819 | 0.6733 | 4.3027 | 9 | 85 | 6 |
Arts and humanities | 455,600 | 6.3101 | 0.6068 | 4.6728 | 40 | 43 | 17 |
Engineering and engineering technology | 545,300 | 6.3778 | 0.6170 | 4.6615 | 32 | 52 | 16 |
Health care | 484,100 | 6.1900 | 0.6708 | 4.1924 | 10 | 72 | 18 |
Science and science technology | 443,900 | 6.3077 | 0.6209 | 4.5867 | 32 | 50 | 18 |
Mathematics and computer and information sciences | 299,400 | 6.4409 | 0.5792 | 4.9545 | 67 | 23 | 10 |
Trades (except construction trades and mechanic and repair technologies/technicians), services, natural resources and conservation | 234,900 | 6.3347 | 0.6339 | 4.5215 | 23 | 61 | 16 |
Legal professions and studies | 103,500 | 6.4863 | 0.6449 | 4.5546 | 27 | 63 | 10 |
Construction trades and mechanic and repair technologies/technicians | 0 | .. not available for a specific reference period | .. not available for a specific reference period | .. not available for a specific reference period | .. not available for a specific reference period | .. not available for a specific reference period | .. not available for a specific reference period |
Age | |||||||
18 to 24 years | 1,628,200 | 5.9022 | 0.5644 | 4.6251 | 31 | 11 | 58 |
25 to 34 years | 3,318,100 | 6.1252 | 0.6036 | 4.5607 | 33 | 29 | 38 |
35 to 44 years | 3,246,800 | 6.1555 | 0.6091 | 4.5480 | 30 | 34 | 36 |
45 to 54 years | 2,978,500 | 6.1408 | 0.6054 | 4.5578 | 29 | 34 | 37 |
55 to 64 years | 2,418,300 | 6.0797 | 0.5940 | 4.5806 | 29 | 28 | 43 |
Gender 1 | |||||||
Men+ | 6,870,600 | 6.0050 | 0.6088 | 4.4363 | 23 | 25 | 52 |
Women+ | 6,719,300 | 6.1993 | 0.5888 | 4.7032 | 38 | 33 | 29 |
Often or always have difficulties with daily activities | |||||||
No | 11,564,000 | 6.1006 | 0.5998 | 4.5625 | 30 | 29 | 41 |
Yes | 1,991,100 | 6.1056 | 0.5938 | 4.6025 | 33 | 28 | 39 |
Immigrant status | |||||||
Canadian-born individual | 9,686,900 | 6.0977 | 0.6033 | 4.5397 | 29 | 30 | 41 |
Permanent resident (landed before 2011) | 2,249,600 | 6.1366 | 0.5930 | 4.6298 | 33 | 29 | 38 |
Permanent resident (landed from 2011 to 2015) | 533,500 | 6.0598 | 0.5868 | 4.6083 | 30 | 24 | 46 |
Permanent resident (landed from 2016 to 2021) | 606,900 | 6.1120 | 0.5818 | 4.6786 | 37 | 23 | 40 |
Non-permanent resident | 513,000 | 6.0388 | 0.5746 | 4.6668 | 35 | 17 | 48 |
Racialized group | |||||||
White | 9,227,700 | 6.1029 | 0.6045 | 4.5360 | 29 | 31 | 40 |
South Asian | 1,025,500 | 6.1364 | 0.5848 | 4.6801 | 38 | 24 | 38 |
Chinese | 560,000 | 6.2699 | 0.5880 | 4.7628 | 45 | 30 | 25 |
Black | 542,600 | 6.0402 | 0.5857 | 4.6016 | 32 | 23 | 45 |
Filipino | 482,100 | 5.9042 | 0.5753 | 4.5577 | 22 | 16 | 62 |
Arab | 203,800 | 6.1793 | 0.5950 | 4.6499 | 35 | 33 | 32 |
Latin American | 264,500 | 6.0398 | 0.5820 | 4.6210 | 32 | 23 | 45 |
Southeast Asian | 145,400 | 6.0104 | 0.5745 | 4.6429 | 28 | 19 | 53 |
West Asian | 121,100 | 6.1892 | 0.5938 | 4.6638 | 36 | 32 | 32 |
Korean | 75,800 | 6.1699 | 0.5941 | 4.6460 | 33 | 31 | 36 |
Japanese | 23,200 | 6.1845 | 0.5908 | 4.6787 | 36 | 31 | 33 |
Racialized groups, n.i.e. | 95,400 | 6.1198 | 0.5921 | 4.6231 | 33 | 29 | 38 |
Multiple racialized groups | 343,000 | 6.1698 | 0.5937 | 4.6509 | 36 | 30 | 34 |
Hours worked per week | |||||||
30 or more (full-time) | 11,088,000 | 6.1293 | 0.6056 | 4.5500 | 30 | 32 | 38 |
Less than 30, but more than 0 (part-time) | 1,854,000 | 5.9815 | 0.5664 | 4.6709 | 33 | 17 | 50 |
Union member | |||||||
No | 8,815,300 | 6.1187 | 0.5893 | 4.6404 | 35 | 26 | 39 |
Yes | 4,774,600 | 6.0685 | 0.6166 | 4.4352 | 23 | 35 | 42 |
Job can be done from home 2 | |||||||
No | 7,610,100 | 5.7993 | 0.5978 | 4.3454 | 14 | 14 | 72 |
Yes | 5,979,800 | 6.4850 | 0.6003 | 4.8518 | 51 | 47 | 2 |
Usually worked from home | |||||||
No | 10,535,000 | 5.9985 | 0.5987 | 4.4910 | 24 | 26 | 50 |
Yes | 3,054,900 | 6.4548 | 0.5994 | 4.8347 | 53 | 40 | 7 |
Acemoglu, D. 2024. The Simple Macroeconomics of AI . NBER, Working Paper no. 32487.
Acemoglu, D. and S. Johnson. 2024. Learning from Ricardo and Thompson: Machinery and Labor in the Early Industrial Revolution, and in the Age of AI . NBER, Working Paper no. 32416.
Arntz, M., T. Gregory and U. Zierahn. 2016. The Risk of Automation for Jobs in OECD Countries: A Comparative Analysis . OECD Social, Employment and Migration Working Papers, no. 189. Paris: OECD Publishing.
Autor, D., H. Levy and R. Murnane. 2003. The skill content of recent technological change: An empirical exploration . The Quarterly Journal of Economics 118 (4): 1279–1333.
Beaudry, P., D. A. Green and B. M. Sand. 2016. The Great Reversal in the Demand for Skill and Cognitive Tasks . Journal of Labor Economics 34 (s1): S199–S247.
Broussard, M. 2018. Artificial Unintelligence: How Computers Misunderstand the World . Cambridge: MIT Press.
Bryan, V., Sood, S. and C. Johnston. 2024. Analysis on artificial intelligence use by businesses in Canada, second quarter of 2024 . Analysis in Brief. Statistics Canada Catalogue no. 11-621-M. Ottawa: Statistics Canada.
Cazzaniga, M., Jaumotte, F., Li, L., Melina, G., Panton, A. J., Pizzinelli, C., Rockall, E. J. and M. M. Tavares. 2024. Gen-AI: Artificial intelligence and the future of work . IMF , Working Paper no. 1.
Dingel, J. I. and B. Neiman. 2020. How many jobs can be done at home? Journal of Public Economics 189: 104235.
Eloundou, T., Manning, S., Mishkin, P. and D. Rock. 2023. GPTs are GPTs: An Early Look at the Labor Market Impact Potential of Large Language Models . Stanford Digital Economy Lab, Working Paper.
Feigenbaum, J. J. and D. P. Gross. 2023. Organizational and Economic Obstacles to Automation: A Cautionary Tale from AT&T in the Twentieth Century . NBER, Working Paper no. 29580.
Felten, E., Raj, M. and R. Seamans. 2021. Occupational, Industry, and Geographic Exposure to Artificial Intelligence: A Novel Dataset and its Potential Uses . Strategic Management Journal 42(12): 2195-2217.
Felten, E., Raj, M. and R. Seamans. 2023. How will Language Modelers like ChatGPT Affect Occupations and Industries? SSRN Working Paper.
Frenette, M. and K. Frank. 2020. Automation and Job Transformation in Canada: Who’s at Risk? Analytical Studies Branch Research Paper Series. Statistics Canada Catalogue no. 11F0019M. Ottawa: Statistics Canada.
Frenette, M. and R. Morissette. 2021. Job security in the age of artificial intelligence and potential pandemics . Economic and Social Reports (June). Ottawa: Statistics Canada.
Frey, C. B. and M. A. Osborne. 2013. The Future of Employment: How Susceptible Are Jobs to Computerisation? Oxford Martin Programme on the Impacts of Future Technology. Oxford: Oxford Martin School, University of Oxford.
Georgieff, A. and R. Hyee. 2021. Artificial intelligence and employment: New cross-country evidence . OECD Social, Employment and Migration Working Papers, no. 265. Paris: OECD Publishing.
Georgieff, A. and A. Milanez. 2021. What happened to jobs at high risk of automation? OECD Social, Employment and Migration Working Papers, no. 255. Paris: OECD Publishing.
Graetz, G. and G. Michaels. 2018. Robots at work . The Review of Economics and Statistics 100 (5): 753–768.
Kochhar, R. 2023. Which U.S. Workers Are More Exposed to AI on Their Jobs? Pew Research Center.
McElheran, K. Li, J. F., Brynjolfsson, E., Kroff, Z., Dinlersoz, E., Foster, L. S. and N. Zolas. 2024. AI Adoption in America: Who, What, and Where . NBER, Working Paper no. 31788.
Mehdi, T. and R. Morissette. 2021a. Working from home: Productivity and preferences . StatCan COVID-19: Data to Insights for a Better Canada. Statistics Canada Catalogue no. 45280001. Ottawa: Statistics Canada.
Mehdi, T. and R. Morissette. 2021b. Working from home in Canada: What have we learned so far? Economic and Social Reports (October). Ottawa: Statistics Canada.
Nedelkoska, L. and G. Quintini. 2018. Automation, Skills Use and Training . OECD Social, Employment and Migration Working Papers, no. 202. Paris: OECD Publishing.
OECD. 2023. OECD Employment Outlook 2023: Artificial Intelligence and the Labour Market . Paris: OECD Publishing.
Oschinski, M. and R. Wyonch. 2017. Future Shock? The Impact of Automation on Canada’s Labour Market . C.D. Howe Institute Commentary, no. 472. Toronto: C.D. Howe Institute.
Picot, G. and T. Mehdi. Forthcoming. The provision of high and low skilled immigrant labour to the Canadian economy .
Pizzinelli, C., Panton, A. J., Tavares, M. M., Cazzaniga, M. and L. Li. 2023. Labour market exposure to AI : Cross-country differences and distributional implications . IMF , Staff Discussion Notes no. 216.
Svanberg, M. S., Li, W., Fleming, M., Goehring, B. C. and N. C. Thompson. 2024. Beyond AI Exposure: Which Tasks are Cost-Effective to Automate with Computer Vision? MIT FutureTech, Working Paper.
Webb, M. 2020. The Impact of Artificial Intelligence on the Labor Market . SSRN, Working Paper.
Wootton, C. W. and B. E. Kemmerer. 2007. The Emergence of Mechanical Accounting in the U.S., 1880-1930 . Accounting Historians Journal 34(1): 91-124.
Note of appreciation.
Canada owes the success of its statistical system to a long-standing partnership between Statistics Canada, the citizens of Canada, its businesses, governments and other institutions. Accurate and timely statistical information could not be produced without their continued co-operation and goodwill.
Statistics Canada is committed to serving its clients in a prompt, reliable and courteous manner. To this end, the Agency has developed standards of service which its employees observe in serving its clients.
Published by authority of the Minister responsible for Statistics Canada.
© His Majesty the King in Right of Canada, as represented by the Minister of Industry, 2024
Use of this publication is governed by the Statistics Canada Open Licence Agreement .
Catalogue no. 11F0019M
Frequency: Occasional
Thank you for visiting nature.com. You are using a browser version with limited support for CSS. To obtain the best experience, we recommend you use a more up to date browser (or turn off compatibility mode in Internet Explorer). In the meantime, to ensure continued support, we are displaying the site without styles and JavaScript.
Experimental & Molecular Medicine ( 2024 ) Cite this article
Metrics details
Recognition of the translocation of NLRP3 to various organelles has provided new insights for understanding how the NLRP3 inflammasome is activated by different stimuli. Mitochondria have already been demonstrated to be the site of NLRP3 inflammasome activation, and the latest research suggests that NLRP3 is first recruited to mitochondria, then disassociated, and subsequently recruited to the Golgi network. Although some mitochondrial factors have been found to contribute to the recruitment of NLRP3 to mitochondria, the detailed process of NLRP3 mitochondrial translocation remains unclear. Here, we identify a previously unknown role for Signal transducer and activator of transcription-3 (STAT3) in facilitating the translocation of NLRP3 to mitochondria. STAT3 interacts with NLRP3 and undergoes phosphorylation at Ser727 in response to several NLRP3 agonists, enabling the translocation of STAT3 and thus the bound NLRP3 to mitochondria. Disruption of the interaction between STAT3 and NLRP3 impairs the mitochondrial localization of NLRP3, specifically suppressing NLRP3 inflammasome activation both in vitro and in vivo. In summary, we demonstrate that STAT3 acts as a transporter for mitochondrial translocation of NLRP3 and provide new insight into the spatial regulation of NLRP3.
Introduction.
As the first line of host defense, the innate immune system uses pattern recognition receptors (PRRs) to detect invading pathogens and endogenous cellular damage to activate signaling pathways and maintain homeostasis. Numerous PRRs, including Toll-like receptors (TLRs), RIG‑I‑like receptors (RLRs) and NOD-like receptors (NLRs) 1 , 2 , 3 , have been identified. NLRs are cytosolic PRRs that induce immune responses by forming inflammasomes. Inflammasomes are supramolecular complexes consisting of sensors (NLRs), an adaptor (apoptosis-associated speck-like protein containing a CARD (ASC)) and an executor (caspase-1). Upon activation, the sensors oligomerize and then recruit ASC, which in turn recruits caspase-1 to enable its maturation. Mature caspase-1 is able to convert IL-1 family proteins into their activated forms and cleave gasdermin D (GSDMD) to trigger pyroptosis, which is responsible for inflammatory responses 4 , 5 , 6 , 7 .
The most well-studied inflammasome is the NLRP3 inflammasome. The NLRP3 inflammasome can be activated by diverse stimuli, including components of pathogens, environmental particles, and endogenous damage signals. The NLRP3 inflammasome promotes host defense against infections; however, its aberrant activation leads to several metabolic- and aging-associated inflammatory disorders, such as atherosclerosis, gout, diabetes, and Alzheimer’s disease. Notably, NLRP3 gain-of-function mutations cause autoinflammatory cryopyrin-associated periodic syndrome (CAPS). Thus, the NLRP3 inflammasome has attracted much attention because it is a highly relevant target for therapeutic intervention 8 , 9 , 10 .
NLRP3 inflammasome activation is accomplished through a two-step process comprising a priming step and an activation (or assembly) step. The priming signal is provided by pathogen ligands, such as Lipopolysaccharides (LPS), and inflammatory cytokines, such as TNF-α, which can greatly upregulate NLRP3 and IL-1β expression. Priming also mediates posttranslational modifications (PTMs) on NLRP3, which positively or negatively regulate the inflammasome. The activation signal is provided by different stimuli, such as ATP, nigericin, or monosodium urate (MSU), triggering the formation and full activation of the NLRP3 inflammasome 11 , 12 . Despite several proposed explanations, including potassium efflux, lysosomal disruption, ROS production, metabolic changes and trans-Golgi disassembly, the mechanism through which NLRP3 senses numerous stimuli remains unclear. Recently, the observation of the recruitment of NLRP3 to the Golgi and endosomal network, as well as its previously described recruitment to mitochondria and the endoplasmic reticulum (ER), have provided deep insight into how NLRP3 is activated; that is, NLRP3 needs to be in the “right place” for activation 12 . Via experiments with a live-cell multispectral time-lapse tracking system, a recent study further demonstrated that NLRP3 is translocated to mitochondria at approximately 10–15 min post stimulation 13 and is then disassociated from mitochondria and subsequently recruited to the Golgi network. This work, in addition to previous studies, have demonstrated that mitochondrial localization is required for NLRP3 activation. Although three factors (cardiolipin, mitochondrial antiviral signaling protein (MAVS), and mitofusin-2) 14 , 15 , 16 on the surface of mitochondria have been suggested to bind NLRP3 and recruit it to mitochondria, the process by which NLRP3 is transported to mitochondria is not clear.
To clarify the underlying mechanism, we investigated a series of endogenous cellular signals by screening small compounds. Surprisingly, we observed that treatment with an inhibitor of STAT3 decreased the mitochondrial localization of NLRP3 and suppressed NLRP3 inflammasome activation both in vitro and in vivo. STAT3 is a transcription factor that mediates numerous acute and chronic inflammatory processes and has a noncanonical role in regulating the function of the mitochondrial electron transport chain (ETC) 17 , 18 , 19 . Here, we demonstrated that STAT3 promotes the translocation of NLRP3 to mitochondria and its subsequent activation, revealing a new role for STAT3 in the spatial regulation of NLRP3.
Wild-type C57BL/6 mice (6–8 weeks old) were purchased from Hunan SJA Laboratory Animal Co., Ltd. (Changsha, China). All the animals were housed under specific pathogen-free (SPF) conditions in the Central South University Animal Facility. The animal experiments were conducted in accordance with the Institutional Animal Care and Use Committee of Central South University.
Small molecule compounds were purchased from Selleck Co. (Cherry Pick Library 96-well-L2000-Z451886-30 uL). The anti-caspase-1 antibody (Abcam, ab179515), anti-IL-1β antibody (RD Systems, AF-401-NA), anti-NLRP3 antibody (AdipoGen, AG-20B-0014-C100), anti-ASC antibody (AdipoGen, AG-25B-0006-C100), anti-β-actin antibody (Cell Signaling Technology, #3700), anti-STAT3 antibody (Cell Signaling Technology, #4904), anti-pY705-STAT3 antibody (Cell Signaling Technology, #9145), anti-pS727-STAT3 antibody (Cell Signaling Technology, #9134), anti-GAPDH antibody (Cell Signaling Technology, #2118), anti-VDAC antibody (Cell Signaling Technology, #4866), anti-LaminA/C antibody (Cell Signaling Technology, #4777), anti-DYKDDDDK tag antibody (Cell Signaling Technology, #2368), and anti-Myc-Tag Antibody (Cell Signaling Technology, #2272) were obtained from the indicated suppliers. Sheep anti-rabbit IgG-h + l DyLight 488 conjugate (BETHY, A120-100D2), Alexa Fluor 594 goat anti-mouse IgG (Biolegend, 405326), and protein A/G-agarose beads (Santa Cruz, sc-2003) were obtained from the indicated suppliers. Anti-Flag affinity gel (Sigma, A2220) and Pierce Anti-c-Myc agarose (Thermo Fisher Scientific, 20168) were obtained from the indicated suppliers. MitoTracker Red CMXRos (Invitrogen, M7512), MitoTracker Deep Red FM (Invitrogen, M22426), a Duolink In Situ Detection Reagents Red Kit (Sigma, DUO92008), Duolink In Situ PLA Probe Anti-Mouse MINUS (Sigma, DUO82004), and Duolink In Situ PLA Probe Anti-Rabbit PLUS (Sigma, DUO82002) were obtained from the indicated suppliers. Cell lysis buffer (Cell Signaling Technology, 9803 S), BCA Protein Assay Kits (Thermo Scientific, 23225), and an LDH Cytotoxicity Assay Kit (Beyotime, C0017) were obtained from the indicated suppliers.
Wild-type C57BL/6 mice were injected intraperitoneally with 3% thioglycollate, and three days later, primary macrophages were harvested in RPMI 1640 medium by peritoneal lavage; the purity of the isolated primary macrophages was as high as 95%, as determined by flow cytometry (Supplementary Fig. 1 ). Primary peritoneal macrophages were seeded into 6-well plates, 24-well plates, or 48-well plates depending on the experiment.
Different agonists and stimuli were used in this study as previously described in ref. 20 . For NLRP3 inflammasome activation, peritoneal macrophages were primed with LPS (100 ng/mL) for 3 h and then stimulated with ATP (5 mM, 1 h), nigericin (10 μM, 1 h) or MSU (200 μg/mL, 6 h). For AIM2 inflammasome activation, after priming, cells were transfected with poly(dA:dT) (1 μg/mL) using Lipofectamine 3000. For NLRC4 inflammasome activation, primed macrophages were transfected with Flagellin (2 μg/mL) with Lipofectamine 3000 for 1 h.
HEK293T cells were obtained from the American Type Culture Collection (Manassas, VA) and cultured in DMEM supplemented with 10% fetal bovine serum, 100 U/mL penicillin and 100 μg/mL streptomycin.
The NLRP3, caspase-1, pro-IL-1β, ASC and NEK7 plasmids were constructed as previously described in ref. 20 . The full-length sequence of STAT3 was amplified from iBMDM cDNA, and the sequences of the primers used were as follows: 5′-AACGGGCCCTCTAGACTCGAG ATGGCTCAGTGGAACCAGCTGCAGCAGCTGGA-3′ and 3′-TAGTCCAGTGTGGTGGAATTC CATGGGGGAGGTAGCACACTCCGAGGTCAGAT-5′. Then, the sequence was cloned and inserted into pcDNA3.1 vectors that contained different tags. Then, the plasmids were transiently transfected into HEK293T cells with linear polyethylenimine at a 1:3 mass:volume ratio. The cell culture medium was changed 6–8 h after transfection, and culture was continued. Then, the cells were collected 18–24 h later for Western blot analysis.
Peritoneal macrophages stimulated as indicated or transfected HEK293T cells were lysed in cold IP buffer containing 50 mM Tris HCl (pH 7.4), 50 mM EDTA, 200 mM NaCl, 1% NP-40 and a protease inhibitor cocktail (Roche, 11873580001). The macrophage lysate was incubated with a primary antibody at 4 °C overnight to allow the formation of antigen-antibody complexes. The formed antigen-antibody complexes were coincubated with protein A/G-agarose beads at 4 °C for 2 h, washed three times with IP buffer, and then eluted in loading buffer. The HEK293T cell lysates were directly incubated with anti-Flag affinity gel or anti-c-Myc agarose at 4 °C for 2 h, after which the gel/agarose was washed 5 times with IP buffer and the complexes were eluted in loading buffer. The eluted samples were subjected to immunoblot analysis.
For immunoblot analysis, stimulated macrophages were lysed in cell lysis buffer supplemented with protease inhibitor cocktail and the phosphatase inhibitor PMSF. The protein concentration after lysis was determined by a BCA protein assay kit. The quantified proteins were separated by sodium dodecyl sulfate‒polyacrylamide gel electrophoresis and then transferred onto a 0.2 µM nitrocellulose membrane for immunoblot analysis.
For siRNA-mediated silencing of STAT3, cells were cultured in 24-well plates (2 × 10 5 cells per well) or 6-well plates (9 × 10 5 cells per well), and the siRNAs were then transfected with RNAiMAX Transfection Reagent (Invitrogen, 13778) following the manufacturer’s instructions. Seventy-two hours after transfection, the cells were stimulated with different inflammasome agonists. The siRNA target sequence was 5′- GCUGAAAUCAUCAUGGGCUAUTT -3′, and the scrambled negative control siRNA sequence was 5′- UUCUCCGAACGUGUCACGU-3′. The silencing efficiency was examined by western blotting using the corresponding antibodies. The indicated scrambled siRNAs were chemically synthesized by Sangon Biotech (Shanghai) Co., Ltd.
RNA was extracted using an RNA Fast 200 Kit (Fastagen, 22001). Complementary DNA was synthesized by using TransScript All-in-One First-Strand cDNA Synthesis SuperMix for qPCR (TransGen Biotech) according to the manufacturer’s protocols. Quantitative PCR was performed using SYBR Green (Vazyme Biotech) on a LightCycler 480 instrument (Roche Diagnostics), and the expression level of each target mRNA was individually normalized to that of β-actin. The sequences of the q-PCR primers used in this study are listed in the table below:
Gene Name | Primer Direction | Sequence |
---|---|---|
NLRP3 | Forward | TGGATGGGTTTGCTGGGAT |
Reverse | CTGCGTGTAGCGACTGTTGAG | |
STAT3 | Forward | CAATACCATTGACCTGCCGAT |
Reverse | GAGCGACTCAAACTGCCCT | |
β-actin | Forward | AGTGTGACGTTGACATCCGT |
Reverse | GCAGCTCAGTAACAGTCCGC | |
pro-IL-1β | Forward | GCAACTGTTCCTGAACTCAACT |
Reverse | ATCTTTTGGGGTCCGTCAACT |
To evaluate ASC speck formation, peritoneal macrophages were seeded on chamber slides and allowed to attach overnight. The following day, the cells were primed with LPS and treated with nigericin in the presence or absence of the indicated inhibitors. Then, the cells were fixed with 4% paraformaldehyde in PBS for 15 min and washed three times in PBS with Tween 20 (PBST) prior to permeabilization with 0.1% Triton X-100 for 10 min. After blocking with 3% bovine serum albumin in PBS for 1 h, the cells were incubated with primary antibodies overnight at 4 °C. After washing with PBST, the cells were incubated with secondary antibodies in 3% bovine serum albumin for 30 min, and nuclei were then stained with DAPI (Beyotime, P0131). The cells were visualized by fluorescence microscopy (Nikon Ti2-U).
Proximity ligation assays were performed using Duolink reagents (Sigma) according to the manufacturer’s instructions to visualize the interaction between the STAT3 and NLRP3 proteins and their localization in mitochondria-resident mouse peritoneal macrophages. To study the interaction between STAT3 and NLRP3, cells were grown on PTFE printed microscope slides (Electron Microscopy Science, 63423-08) and subjected to canonical stimulation of the NLRP3 pathway in the presence or absence of the mitochondrial dye MitoTracker Deep Red FM. The cells were fixed, permeabilized, blocked, and then incubated with primary antibodies overnight at 4 °C. After incubation with the primary antibodies, the cells were incubated with a combination of the corresponding PLA probes and secondary antibodies conjugated to oligonucleotides for 1 h at 37 °C. After washing with buffer A [0.01 M Tris-HCl (pH 7.4), 0.15 M NaCl, 0.05% Tween 20], the cells were incubated with ligation mix (Sigma, DUO92008) for 30 min at 37 °C to allow the formation of a closed circle DNA template when the PLA probes were bound in close proximity. After washing with buffer A, the cells were incubated with polymerase mix (Sigma, DUO92008) for 100 min at 37 °C to allow rolling circle amplification. After sequential washes with buffer B [0.2 M Tris-HCl (pH 7.4), 0.1 M NaCl] and buffer C (10-fold dilution of buffer B with water), cover slips (Citotest, 10212450 C) were mounted onto the microscopy slides. The cells were imaged using a 63×/1.4 oil immersion objective on a Leica STELLARIS 5 confocal microscope (Leica).
Primed cells were treated with DMSO or with napabucasin followed by nigericin for 30 min. At the same time, the cells were stained for 30 min at 37 °C with 100 nM MitoTracker Red CMXRos (Invitrogen, M7512) in the dark. After washing three times with warm PBS, the cells were fixed with 4% paraformaldehyde in PBS for 15 min and permeabilized with 0.1% Triton X-100 for 10 min. After blocking with 3% bovine serum albumin in PBS for 1 h, the cells were incubated overnight at 4 °C with primary antibodies (anti-NLRP3 and anti-STAT3 antibodies). After washing with PBST, the cells were incubated with Sheep anti-rabbit IgG-h + l DyLight 488 conjugate and Alexa Fluor 594-conjugated goat anti-mouse IgG in PBS containing 3% BSA for 30 min and rinsed in PBST. Nuclei were stained with DAPI (Beyotime, P0131). Images were analyzed by using a 63×/1.4 oil immersion objective on a Leica STELLARIS 5 confocal microscope (Leica).
Peritoneal macrophages were collected and resuspended at a density of 4 × 10 5 cells/mL in a 1.5 mL Eppendorf tube and were then washed with ice-cold PBS. The macrophages were resuspended in RIPA lysis buffer containing the protease inhibitor cocktail. The cell lysates were centrifuged at 12,000 × g for 15 min at 4 °C, after which the supernatants were collected. The lysate supernatants were incubated with napabucasin (20 μM) or the control (DMSO) for 1 h at room temperature. Then, each drug-treated cell lysates was aliquoted into PCR tubes (60 μL each), and the tubes were heated at different temperatures (37, 47, 57, 67, 77, and 87 °C) for 5 min in the PCR apparatus and then cooled at room temperature for 3 min. The soluble fractions were separated after centrifugation of the lysates at 20,000 × g for 20 min at 4 °C, transferred to new microcentrifuge tubes, and analyzed by SDS‒PAGE followed by western blotting with anti-NLRP3 and anti-STAT3 antibodies.
The cytoplasmic and nuclear fractions were separated from lysates of peritoneal macrophages using a cytoplasmic and nuclear fractionation kit (Beyotime, P0028) according to the manufacturer’s guidelines. Then, the isolated protein components were quantified by a BCA assay and analyzed by immunoblotting.
Supernatants from cell cultures and sera were analyzed using IL-1β and TNF-a ELISA kits (Invitrogen, 88-5019-88, 88-7324-88) according to the manufacturer’s instructions. Cell death was assessed with an LDH Cytotoxicity Assay Kit (Beyotime, C0017) according to the manufacturer’s instructions.
Wild-type C57BL/6 male mice were injected with saline or napabucasin (5 mg/kg) half an hour before injection with LPS (20 mg/kg body weight) and were then monitored for 8 h. The mice were deeply anesthetized with sodium pentobarbital (70 mg/kg, i.p.), and the cardiac blood and left lung were collected from each mouse. Then, the serum concentrations of IL-1β and TNF-α were measured by ELISA, and lung damage was evaluated by HE staining.
Wild-type C57BL/6 male mice were intraperitoneally injected with saline or napabucasin (5 mg/kg), half an hour before injection of 2 mg of MSU (dissolved in 300 μL of saline) and were then monitored for 6 h. After the mice were killed, the peritoneal lavage fluid was collected by lavage of the peritoneal cavity with ice-cold PBS; the lavage fluid was concentrated for ELISA, and neutrophils were counted.
The data were analyzed using GraphPad Prism software (version 9.5.0). The data are presented as the standard deviation of the mean (SD) or standard error of the mean (SEM), depending on the experiment. Independent sample t-tests and two-way ANOVA followed by the Bonferroni correction were performed in this study. Differences with a p -value < 0.05 were considered to be statistically significant, and the details of the statistical analyses can be found in the figure legends. In the animal studies, the mice were randomly divided into different groups, and all the samples were processed in a blinded manner. For western blotting, qPCR and other quantitative methods, experiments were performed at least three times.
To elucidate whether endogenous cellular signals are involved in NLRP3 translocation, we detected IL-1β secreted in response to treatment with NLRP3 agonists (LPS+nigericin) and screened 395 small compounds obtained from Selleck Co. (Supplementary Table 1 ) for their ability to inhibit IL-1β secretion (Fig. 1a ). These compounds were inducers or inhibitors of numerous intrinsic signaling pathways, including the MAPK, PI3K/AKT/mTOR, JAK-STAT, TGF-β-Smad, and integrin signaling pathways. We treated macrophages with the compounds after treatment with LPS to focus on regulation at the NLRP3 inflammasome activation stage rather than the priming stage (Fig. 1a ). Intriguingly, 20 compounds inhibited IL-1β secretion by at least 90%, and three of them, namely, napabucasin, BP-1-102 and C188-9, attracted our attention (Fig. 1b ) since they are inhibitors of STAT3.
a Screening for small molecule compounds obtained from Selleck Co. This figure template, “Screening flow chart,” was assembled using dynamic BioRender assets (icons, lines, shapes and/or text) and is fully editable. b Percentage inhibition of IL-1β secretion by each compound. The IL-1β secretion level relative to 10% of that in the control group was used as a cutoff (left), and the chemical structures of the compounds napabucasin, BP-1-102 and C188-9 used to inhibit STAT3 are shown (right).
To further confirm the function of STAT3 inhibitors in inflammasome activation, we treated macrophages with nigericin, ATP and MSU, which activate the NLRP3 inflammasome via different mechanisms, as well as with flagellin and poly(dA:dT), which activate the NLRC4 and AIM2 inflammasomes, respectively. Given that napabucasin has been applied in clinical trials, we chose to use napabucasin for follow-up experiments 21 , 22 . We observed that napabucasin greatly inhibited IL-1β secretion but not TNF-α secretion in response to stimulation of the NLRP3 inflammasome, although it had no effect on the NLRC4 or AIM2 inflammasome. Accordingly, lactic acid dehydrogenase (LDH) release triggered by NLRP3 stimulation was also impaired by napabucasin treatment (Fig. 2a ). This observation was also verified by the detection of cleaved caspase-1 (p10) and pro-IL-1β (p17) in the supernatants of macrophages treated with these agonists (Fig. 2b, c ). We also noted that napabucasin barely affected the protein levels of NLRP3 and pro-IL-1β after LPS priming (Fig. 2b, c ), excluding its role in the regulation of the NF-κB pathway. ASC speck formation is a hallmark of NLRP3 inflammasome assembly and can be monitored by immunofluorescence staining. We further observed that napabucasin inhibited ASC speck formation in ATP- and nigericin-treated macrophages but not in flagellin- or poly(dA:dT)-treated macrophages (Fig. 2d ). Thus, these results demonstrate that STAT3 inhibitors specifically suppress the activation of the NLRP3 inflammasome, suggesting that STAT3 may be involved in the regulation of NLRP3 inflammasome assembly via an unknown mechanism.
a ELISA of IL-1β and TNF-α secretion and assay of LDH release in supernatants from LPS-primed mouse peritoneal macrophages treated with 10 μM napabucasin for 30 min followed by the indicated stimulators of different inflammasomes. The experiments were repeated at least three times, and representative data are shown. b , c Immunoblot analysis of supernatants (SN) or cell lysates (Cell) from mouse peritoneal macrophages treated with the indicated stimulators of the NLRP3 ( b ), NLRC4 or AIM2 inflammasome with or without napabucasin ( c ). d Representative images of ASC specks in peritoneal macrophages treated with the indicated stimuli; ASC, green; nuclei, blue. The white arrows indicate ASC specks. Scale bar: 20 μm. The percentage of cells containing an ASC speck was quantified (right). At least 100 peritoneal macrophages from each genotype were analyzed. The results are presented as the means ± SDs, and representative photographs from three biologically independent experiments with similar results are shown. Statistical analyses were carried out via two-way ANOVA with the Bonferroni correction in ( a , d ). * P < 0.05, ** P < 0.01 and *** P < 0.001.
Next, we examined the role of STAT3 in the regulation of the NLRP3 inflammasome. STAT3 was knocked down in mouse primary macrophages by siRNA transfection (Fig. 3a ), and silencing STAT3 indeed suppressed IL-1β secretion in macrophages treated with NLRP3, NLRC4, or AIM2 agonists (Fig. 3b ). We found that silencing STAT3 also decreased NLRP3 and pro-IL-1β expression at the translational and transcriptional levels 23 , 24 , 25 (Fig. 3c, d ), in contrast to the results obtained with the STAT3 inhibitor. These effects of STAT3 silencing were consistent with those observed in previous studies indicating that STAT3 could promote NLRP3 and IL-1β expression at the transcriptional level. Taken together, these findings indicate that either knockdown of STAT3 or blockade of STAT3 by treatment with inhibitors can suppress NLRP3 inflammasome activation via different mechanisms.
a Quantitative PCR analysis of STAT3 mRNA expression in mouse peritoneal macrophages after transfection with NC-siRNA or STAT3-siRNA for 48 h. b IL-1β and TNF-α secretion in supernatants from mouse peritoneal macrophages transfected as described in ( a ) and then treated with the indicated stimuli. c , d Relative NLRP3 and IL-1β mRNA expression ( c ) in peritoneal macrophages treated with LPS for 2 h and 4 h or not treated after transfection as described in ( a ). Target mRNA expression was normalized to the expression of β-actin as the reference gene. Immunoblot analysis of NLRP3 and Pro-IL-1β expression in mouse peritoneal macrophages transfected as described; the photographs are representative of three biologically independent experiments with similar results ( d ). The results are presented as the means ± SDs; n = 3 biologically independent experiments ( a – c ). Statistical analyses were carried out via independent sample t-test in ( a ) or two-way ANOVA with the Bonferroni correction in ( b , c ). * P < 0.05, ** P < 0.01 and *** P < 0.001.
To further study the nontranscriptional function of STAT3 in NLRP3 inflammasome activation, we examined the distribution of STAT3 during the process of NLRP3 inflammasome activation. STAT3 translocated to the nucleus upon LPS treatment (Fig. 4a ), as suggested by a previous study. Intriguingly, upon the addition of nigericin or ATP, STAT3 was located primarily in the cytoplasm (Fig. 4a ), suggesting that cytoplasmic STAT3 may play a role in the assembly of the NLRP3 inflammasome. Therefore, we investigated whether cytoplasmic STAT3 can interact with NLRP3 inflammasome components. By overexpressing STAT3 with NLRP3, ASC, NEK7 or caspase-1 in HEK293T cells, we found that STAT3 could interact with NLRP3 but not with ASC, NEK7 or caspase-1 (Fig. 4b ). This interaction was verified by immunoprecipitation in primary macrophages, and nigericin treatment dramatically promoted the association between STAT3 and NLRP3 (Fig. 4c ). A PLA (proximity ligation assay) assay was further used to demonstrate this interaction in primary macrophages (Fig. 4d ). Moreover, to determine which domains of STAT3 and NLRP3 are required for this interaction, we constructed plasmids expressing different truncation mutants of STAT3 and NLRP3. We observed that the DBD of STAT3 and at least two domains, the PYD and LRR domains, of NLRP3 mediate the interaction between STAT3 and NLRP3 (Fig. 4e, f ). Thus, cytoplasmic STAT3 interacts with NLRP3 at the NLRP3 inflammasome activation stage.
a Immunoblot analysis of cytoplasmic and nuclear components after treatment with the corresponding stimuli described above. b Immunoprecipitation and immunoblot analysis of lysates from HEK293T cells transfected with Flag-STAT3, Myc-NLRP3, Myc-ASC, Myc-STAT3, Flag-caspase-1, or Flag-Nek7. Immunoprecipitation was performed with anti-Flag (up) and anti-Myc (down) antibodies, and immunoblotting was performed with anti-Myc and anti-Flag antibodies, respectively. c Immunoblot analysis of lysates from mouse peritoneal macrophages treated with the indicated stimuli. IP was performed with an anti-STAT3 antibody, and immunoblotting was then performed with an anti-NLRP3 antibody. d The physical interaction between NLRP3 and STAT3 was visualized as red puncta by a PLA in mouse peritoneal macrophages primed with 100 ng/mL LPS for 3 h and then stimulated with nigericin (10 μM) or ATP (5 mM) for 1 h. Scale bar: 20 μm. e Myc-tagged NLRP3 or its mutants and Flag-STAT3 were cotransfected into HEK293T cells for 24 h prior to immunoprecipitation with anti-Myc beads and western blotting (bottom). Schematic diagram of NLRP3 and its truncation mutants (top). f Myc-STAT3 or its mutants and Flag-NLRP3 were cotransfected into HEK293T cells for 24 h prior to immunoprecipitation with anti-Myc beads and western blotting (bottom). Schematic diagram of STAT3 and its truncation mutants (top). The results are presented as the means ± SDs, and representative photographs of three biologically independent experiments with similar results are shown.
Then, we further investigated the mechanism by which cytoplasmic STAT3 regulates NLRP3 inflammasome activation. Since STAT3 has been reported to regulate ETC function in mitochondria 19 , 26 , we speculated that the mitochondrial function of STAT3 contributes to NLRP3 inflammasome activation. We observed that treatment with the NLRP3 agonists nigericin and ATP increased Ser727 phosphorylation of STAT3 (Fig. 5a ), which is a marker for STAT3 translocation to mitochondria 19 , 23 . Intriguingly, the STAT3-NLRP3 complex was colocalized with a mitochondrial marker (MitoTracker) (Fig. 5b ). Thus, these results indicate that STAT3 can transport NLRP3 to mitochondria, as the translocation of NLRP3 to mitochondria has been reported to play a pivotal role in its activation. To verify this hypothesis, we sought to disrupt the interaction between STAT3 and NLRP3. Given that knockdown of STAT3 suppresses the expression of NLRP3, we cannot exclude the transcriptional effect of STAT3 on the regulation of NLRP3 inflammasome. Instead, we used napabucasin for the mechanistic study because it has been reported to bind to the SH2 domain of STAT3 and block STAT3 activity 21 , 27 . We first evaluated the potential of napabucasin to bind to STAT3 by a cellular thermal shift assay (CETSA) 28 , which detects the thermal stability of a protein upon ligand binding. Napabucasin increased the thermal stability of STAT3 but not that of NLRP3 (Fig. 5c ), indicating that napabucasin indeed binds to STAT3. Thus, napabucasin was appropriate for use in subsequent mechanistic studies. The translocation of NLRP3 to mitochondria was significantly impaired in macrophages treated with napabucasin compared to control macrophages (Fig. 5d ). Furthermore, napabucasin disrupted the interaction between STAT3 and NLRP3 during the assembly of the NLRP3 inflammasome after stimulation with LPS or Pam3CSK4, which activate the TLR4 and TLR1/2 pathways, respectively (Fig. 5e , Supplementary Fig. 2 ), but did not affect Ser727 phosphorylation of STAT3 (Fig. 5f ). Taken together, these findings demonstrated that STAT3 mediates the translocation of NLRP3 to mitochondria for further activation of the NLRP3 inflammasome.
a Immunoblot analysis of cytoplasmic components using a cytoplasmic and nuclear fractionation kit after treatment with the corresponding stimuli described above. b The interaction between NLRP3 and STAT3 and the co-localization with mitochondria (red) in peritoneal macrophages were visualized by a PLA (green) and confocal microscopy. Scale bar: 10 μm. c Cellular thermal shift assay (CETSA) of STAT3 or NLRP3 with napabucasin (20 μM). d LPS-primed peritoneal macrophages were treated with the indicated stimuli. The colocalization of NLRP3 with mitochondria was visualized by immunofluorescence microscopy. Mitochondria were stained with MitoTracker CMXRos, NLRP3 was detected with Alexa Fluor 488, and cellular nuclei were stained with DAPI. The imaging data are representative of several images from three independent experiments. Scale bar: 20 μm. e Immunoprecipitation and immunoblot analysis of lysates from mouse peritoneal macrophages treated with the indicated stimuli with or without napabucasin (10 μM) prior to IP with an anti-STAT3 antibody and immunoblotting with an anti-NLRP3 antibody. f Cytoplasmic components were extracted with a cytoplasmic and nuclear extraction kit after stimulation as described above and were then analyzed by Western blotting. The results are presented as the means ± SDs, and representative photographs of three biologically independent experiments with similar results are shown.
Finally, we explored the potential of targeting STAT3 to alleviate NLRP3-associated inflammation. We established a model of peritonitis in mice by intraperitoneal (i.p.) injection of MSU, in which inflammation is NLRP3 inflammasome dependent. MSU challenge induced neutrophil infiltration and IL-1β secretion in peritoneal fluids, whereas napabucasin pretreatment reduced both of these parameters (Fig. 6a, b ). In another LPS-induced endotoxin model, napabucasin exhibited anti-inflammatory effects by decreasing the serum IL-1β level and reducing lung tissue damage, alveolar edema and neutrophil infiltration compared with mice those in mice only challenged with LPS (Fig. 6c–e ). Thus, targeting STAT3 could be a potential treatment strategy for NLRP3-associated inflammation.
a , b Wild-type C57BL/6 mice were administered DMSO or napabucasin (5 mg/kg) via intraperitoneal (i.p.) injection 30 min before i.p. injection of MSU (2 mg per mouse) ( n = 5 biologically independent mice) for 6 h. Quantification of neutrophils ( a ) and ELISA of IL-1β secretion (b) in the peritoneal lavage fluid. c – e Wild-type C57BL/6 mice were administered 20 mg/kg LPS via intraperitoneal (i.p.) injection ( n = 5 biologically independent mice) for 8 h with or without napabucasin (5 mg/kg). ELISA results showing the serum concentrations of IL-1β ( c ) and IL-6 ( d ) and images of H&E-stained lung tissue sections ( e ). Scale bar: 50 μm. The data are representative of three independent experiments. The results are presented as the means ± SEMs. Statistical analyses were carried out via two-way ANOVA in ( a – d ). * P < 0.05, ** P < 0.01 and *** P < 0.001.
Accumulating evidence has revealed that mitochondria play a crucial role in NLRP3 inflammasome activation via several mechanisms, including acting as scaffolds for the localization of NLRP3, releasing mitochondrial DNA (mtDNA) and mitochondrial ROS (mtROS) into the cytoplasm, and providing ATP for NLRP3 signaling, all of which contribute to the formation and activation of the NLRP3 inflammasome 29 , 30 . Although cardiolipin, MAVS and mitofusin-2 on the surface of mitochondria have been suggested to bind NLRP3 and recruit it to mitochondria 14 , 15 , 16 , how NLRP3 is translocated to mitochondria remains largely unknown. In this study, we demonstrated that STAT3 acts as a transporter for NLRP3 translocation to mitochondria (Fig. 7 ) and that blocking the interaction between STAT3 and NLRP3 by treatment with a STAT3 inhibitor substantially reduced NLRP3 inflammasome activation both in vitro and in vivo.
STAT3 promotes NLRP3 inflammasome activation by mediating NLRP3 mitochondrial translocation, and this process is inhibited by napabucasin through disruption of the interaction between STAT3 and NLRP3.
The knowledge of the translocation of NLRP3 to various organelles represents the greatest advancement in the field. Zhijian J. Chen’s group reported that diverse NLRP3 stimuli induce disassembly of the trans-Golgi network (TGN), after which the dispersed TGN (dTGN) serves as a scaffold for NLRP3 oligomerization and activation 31 . That work provided a new direction for exploring the underlying mechanism of NLRP3 activation. Subsequent studies revealed that BTK 32 , IKKβ 33 , and GSK3β 13 are involved in regulating the location of NLRP3 in the dTGN. The most recent study showed, by using a live-cell multispectral time-lapse tracking system, that NLRP3 first translocates to mitochondria at approximately 10–15 min post stimulation and is subsequently recruited to the Golgi network 12 . This work, combined with previous studies, highlights the importance of NLRP3 translocation to mitochondria. In the present study, we also observed the translocation of NLRP3 to mitochondria upon stimulation of NLRP3, and disruption of NLRP3 mitochondrial translocation impaired the activation of the NLRP3 inflammasome. In mediating the translocation of NLRP3 to mitochondria, STAT3 mostly acts as a transporter by binding to NLRP3, which is different from the mechanism by which BTK, IKKβ and GSK3β in regulate the localization of NLRP3 to the dTGN. BTK 32 , IKKβ 33 and GSK3β 13 regulate the localization of NLRP3 to the dTGN in a manner dependent on their kinase function. For example, BTK phosphorylates specific tyrosine residues in the polybasic region of NLRP3, resulting in charge reversal in this region. This change promotes NLRP3 disassociation from the dTGN 32 . IKKβ and GSK3β have similar functions, but NLRP3 is not one of their substrates 13 , 33 . Previous studies have reported that Cardiolipin, MAVS and mitofusin-2 mediate the recruitment of NLRP3 to mitochondria by interacting with NLRP3 14 , 15 , 16 . However, these factors are located on the surface of mitochondria or the inner mitochondrial membrane; thus, how can they enable the translocation of cytosolic NLRP3 to mitochondria? Our results partially answer this question and provide a new explanation for the translocation of NLRP3 to mitochondria; i.e., that it is mediated by a transporter. Future work is needed to explore this dynamic process.
STAT3, a member of the STAT protein family, is a transcription factor that extensively participates in the regulation of acute and chronic inflammation, autoimmunity, metabolism, development and cancer progression 34 , 35 , 36 . It can be activated by various cytokines and growth factors, including IL-6, IL-10, IL-11, interferon, EGF, and HGF 37 . Upon activation, STAT3 is phosphorylated at two well-studied sites, Tyr705 and Ser727. When STAT3 undergoes phosphorylation at Tyr705, it is transported to the nucleus, where it can specifically bind to DNA for transcriptional activation 34 . The transcriptional regulation of NLRP3 and IL-1β by STAT3 has been investigated by several groups; however, no group has revealed a transcriptionally independent role for STAT3 in NLRP3 inflammasome regulation. By treatment with an inhibitor of STAT3 after LPS priming, we revealed the noncanonical function of STAT3 in NLRP3 inflammasome activation. This noncanonical function relies on Ser727 phosphorylation. When STAT3 undergoes phosphorylation at Ser727, it is transported to mitochondria and regulates ETC function 18 , 23 . Intriguingly, NLRP3 agonists can trigger Ser727 phosphorylation of STAT3; although the mechanism underlying this process is unknown, kinases responsible for Ser727 phosphorylation of STAT3 must exist. Several kinases, including EGF, PKC, JNK, ERK1, ERK2 and MAP kinases, have been reported to mediate Ser727 phosphorylation of STAT3 37 , 38 , 39 . Whether these kinases or unknown kinases are involved in this process still needs further investigation. In this study, we demonstrated that napabucasin binds to STAT3, but we cannot exclude the unknown effects of napabucasin on the NLRP3 inflammasome. In future studies, a series of STAT3 mutant mice which lost mitochondrial translocation effect needs to be investigated. In summary, we revealed a new role for STAT3 in regulating the location of NLRP3.
Cao, X. Self-regulation and cross-regulation of pattern-recognition receptor signalling in health and disease. Nat. Rev. Immunol. 16 , 35–50, https://doi.org/10.1038/nri.2015.8 (2016).
Article CAS PubMed Google Scholar
Brubaker, S. W., Bonham, K. S., Zanoni, I. & Kagan, J. C. Innate immune pattern recognition: a cell biological perspective. Annu Rev. Immunol. 33 , 257–290, https://doi.org/10.1146/annurev-immunol-032414-112240 (2015).
Article CAS PubMed PubMed Central Google Scholar
Kawai, T. & Akira, S. The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors. Nat. Immunol. 11 , 373–384, https://doi.org/10.1038/ni.1863 (2010).
Mantovani, A., Dinarello, C. A., Molgora, M. & Garlanda, C. Interleukin-1 and Related Cytokines in the Regulation of Inflammation and Immunity. Immunity 50 , 778–795, https://doi.org/10.1016/j.immuni.2019.03.012 (2019).
Broz, P., Pelegrin, P. & Shao, F. The gasdermins, a protein family executing cell death and inflammation. Nat. Rev. Immunol. 20 , 143–157, https://doi.org/10.1038/s41577-019-0228-2 (2020).
Lamkanfi, M. & Dixit, V. M. Mechanisms and functions of inflammasomes. Cell 157 , 1013–1022, https://doi.org/10.1016/j.cell.2014.04.007 (2014).
Rathinam, V. A., Vanaja, S. K. & Fitzgerald, K. A. Regulation of inflammasome signaling. Nat. Immunol. 13 , 333–342, https://doi.org/10.1038/ni.2237 (2012).
Swanson, K. V., Deng, M. & Ting, J. P. The NLRP3 inflammasome: molecular activation and regulation to therapeutics. Nat. Rev. Immunol. 19 , 477–489, https://doi.org/10.1038/s41577-019-0165-0 (2019).
Sharma, B. R. & Kanneganti, T. D. NLRP3 inflammasome in cancer and metabolic diseases. Nat. Immunol. 22 , 550–559, https://doi.org/10.1038/s41590-021-00886-5 (2021).
Mangan, M. S. J. et al. Targeting the NLRP3 inflammasome in inflammatory diseases. Nat. Rev. Drug Discov. 17 , 588–606, https://doi.org/10.1038/nrd.2018.97 (2018).
Huang, Y., Xu, W. & Zhou, R. NLRP3 inflammasome activation and cell death. Cell Mol. Immunol. 18 , 2114–2127, https://doi.org/10.1038/s41423-021-00740-6 (2021).
Akbal, A. et al. How location and cellular signaling combine to activate the NLRP3 inflammasome. Cell Mol. Immunol. 19 , 1201–1214, https://doi.org/10.1038/s41423-022-00922-w (2022).
Arumugam, S. et al. GSK3beta mediates the spatiotemporal dynamics of NLRP3 inflammasome activation. Cell Death Differ. 29 , 2060–2069, https://doi.org/10.1038/s41418-022-00997-y (2022).
Iyer, S. S. et al. Mitochondrial cardiolipin is required for Nlrp3 inflammasome activation. Immunity 39 , 311–323, https://doi.org/10.1016/j.immuni.2013.08.001 (2013).
Subramanian, N., Natarajan, K., Clatworthy, M. R., Wang, Z. & Germain, R. N. The adaptor MAVS promotes NLRP3 mitochondrial localization and inflammasome activation. Cell 153 , 348–361, https://doi.org/10.1016/j.cell.2013.02.054 (2013).
Tur, J. et al. Mitofusin 2 in Macrophages Links Mitochondrial ROS Production, Cytokine Release, Phagocytosis, Autophagy, and Bactericidal Activity. Cell Rep. 32 , 108079, https://doi.org/10.1016/j.celrep.2020.108079 (2020).
Yang, R. & Rincon, M. Mitochondrial Stat3, the Need for Design Thinking. Int J. Biol. Sci. 12 , 532–544, https://doi.org/10.7150/ijbs.15153 (2016).
Hillmer, E. J., Zhang, H., Li, H. S. & Watowich, S. S. STAT3 signaling in immunity. Cytokine Growth Factor Rev. 31 , 1–15, https://doi.org/10.1016/j.cytogfr.2016.05.001 (2016).
Article PubMed PubMed Central Google Scholar
Wegrzyn, J. et al. Function of mitochondrial Stat3 in cellular respiration. Science 323 , 793–797, https://doi.org/10.1126/science.1164551 (2009).
Wang, D. et al. YAP promotes the activation of NLRP3 inflammasome via blocking K27-linked polyubiquitination of NLRP3. Nat. Commun. 12 , 2674, https://doi.org/10.1038/s41467-021-22987-3 (2021).
Li, Y. et al. Suppression of cancer relapse and metastasis by inhibiting cancer stemness. Proc. Natl Acad. Sci. USA 112 , 1839–1844, https://doi.org/10.1073/pnas.1424171112 (2015).
Jonker, D. J. et al. Napabucasin versus placebo in refractory advanced colorectal cancer: a randomised phase 3 trial. Lancet Gastroenterol. Hepatol. 3 , 263–270, https://doi.org/10.1016/S2468-1253(18)30009-8 (2018).
Article PubMed Google Scholar
Balic, J. J. et al. STAT3 serine phosphorylation is required for TLR4 metabolic reprogramming and IL-1beta expression. Nat. Commun. 11 , 3816, https://doi.org/10.1038/s41467-020-17669-5 (2020).
Samavati, L. et al. STAT3 tyrosine phosphorylation is critical for interleukin 1 beta and interleukin-6 production in response to lipopolysaccharide and live bacteria. Mol. Immunol. 46 , 1867–1877, https://doi.org/10.1016/j.molimm.2009.02.018 (2009).
Zhu, L. et al. STAT3/Mitophagy Axis Coordinates Macrophage NLRP3 Inflammasome Activation and Inflammatory Bone Loss. J. Bone Min. Res 38 , 335–353, https://doi.org/10.1002/jbmr.4756 (2023).
Article CAS Google Scholar
Carbognin, E., Betto, R. M., Soriano, M. E., Smith, A. G. & Martello, G. Stat3 promotes mitochondrial transcription and oxidative respiration during maintenance and induction of naive pluripotency. EMBO J. 35 , 618–634, https://doi.org/10.15252/embj.201592629 (2016).
Tahara, T. et al. STAT3 inhibitory activity of naphthoquinones isolated from Tabebuia avellanedae. Bioorg. Med Chem. 28 , 115347, https://doi.org/10.1016/j.bmc.2020.115347 (2020).
Peng, Y. et al. Lovastatin inhibits Toll-like receptor 4 signaling in microglia by targeting its co-receptor myeloid differentiation protein 2 and attenuates neuropathic pain. Brain Behav. Immun. 82 , 432–444, https://doi.org/10.1016/j.bbi.2019.09.013 (2019).
Xian, H. et al. Oxidized DNA fragments exit mitochondria via mPTP- and VDAC-dependent channels to activate NLRP3 inflammasome and interferon signaling. Immunity 55 , 1370–1385.e1378, https://doi.org/10.1016/j.immuni.2022.06.007 (2022).
Xian, H. et al. Metformin inhibition of mitochondrial ATP and DNA synthesis abrogates NLRP3 inflammasome activation and pulmonary inflammation. Immunity 54 , 1463–1477.e1411, https://doi.org/10.1016/j.immuni.2021.05.004 (2021).
Chen, J. & Chen, Z. J. PtdIns4P on dispersed trans-Golgi network mediates NLRP3 inflammasome activation. Nature 564 , 71–76, https://doi.org/10.1038/s41586-018-0761-3 (2018).
Bittner, Z. A. et al. BTK operates a phospho-tyrosine switch to regulate NLRP3 inflammasome activity. J. Exp. Med. 218 , https://doi.org/10.1084/jem.20201656 (2021).
Nanda, S. K., Prescott, A. R., Figueras-Vadillo, C. & Cohen, P. IKKbeta is required for the formation of the NLRP3 inflammasome. EMBO Rep. 22 , e50743, https://doi.org/10.15252/embr.202050743 (2021).
Reich, N. C. & Liu, L. Tracking STAT nuclear traffic. Nat. Rev. Immunol. 6 , 602–612, https://doi.org/10.1038/nri1885 (2006).
Zou, S. et al. Targeting STAT3 in Cancer Immunotherapy. Mol. Cancer 19 , 145, https://doi.org/10.1186/s12943-020-01258-7 (2020).
Johnson, D. E., O’Keefe, R. A. & Grandis, J. R. Targeting the IL-6/JAK/STAT3 signalling axis in cancer. Nat. Rev. Clin. Oncol. 15 , 234–248, https://doi.org/10.1038/nrclinonc.2018.8 (2018).
Yu, H., Pardoll, D. & Jove, R. STATs in cancer inflammation and immunity: a leading role for STAT3. Nat. Rev. Cancer 9 , 798–809, https://doi.org/10.1038/nrc2734 (2009).
Sgrignani, J. et al. Structural Biology of STAT3 and Its Implications for Anticancer Therapies Development. Int. J. Mol. Sci. 19 , https://doi.org/10.3390/ijms19061591 (2018).
Macias, E., Rao, D., Carbajal, S., Kiguchi, K. & DiGiovanni, J. Stat3 binds to mtDNA and regulates mitochondrial gene expression in keratinocytes. J. Invest Dermatol. 134 , 1971–1980, https://doi.org/10.1038/jid.2014.68 (2014).
Download references
This work was supported by the National Key Research and Development Program of China (2021YFC2500802), the National Natural Science Foundation of China (82272207, 82102281, 82202391, 82000831), the Provincial Natural Science Foundation of Hunan in China (2021JJ20090, 2022JJ20093), the Wisdom Accumulation and Talent Cultivation Project of Third Xiangya Hospital of Central South University (JC202201, YX202201), the Graduate Student Research Innovation Project in Hunan Province (CX20230316), the Key R&D Plan of Hunan Province (NO2023SK2035), and an Openning Project of Key Laboratory of Surgical Critical Care and Life Support (Xi’an Jiaotong University), Ministry of Education (2023SCCLS-KFKT001).
These authors contributed equally: Ling Luo, Fupeng Wang.
Department of Hematology and Critical Care Medicine, Third Xiangya Hospital, Central South University, Changsha, Hunan Province, 410000 P, PR China
Ling Luo, Fupeng Wang, Xueming Xu, Mingliang Ma, Guangyan Kuang, Yening Zhang & Kai Zhao
Department of Dermatology, Third Xiangya Hospital, Central South University, Changsha, Hunan Province, 410000 P, PR China
Department of Rheumatology, First Affiliated Hospital of Zhengzhou University, Zhengzhou, Henan Province, 450000 P, PR China
Department of Blood Transfusion, Second Xiangya Hospital, Central South University, Changsha, Hunan Province, 410000 P, PR China
Ningjie Zhang
Key Laboratory of Sepsis Translational Medicine of Hunan, Central South University, Changsha, Hunan Province, 410000 P, PR China
You can also search for this author in PubMed Google Scholar
K.Z. supervised the whole project; K.Z. and L.L. designed the research; K.Z.L.L. and F.W. wrote the manuscript; L.L. and F.W. performed the experiments, analyzed the data and made the figures; X.X., M.M., G.K. and Y.Z. provided technical assistance; D.W. and W.L. assisted with the data analyses and discussions; and N.Z. assisted in the data interpretation and edited the manuscript.
Correspondence to Kai Zhao .
Competing interests.
The authors declare no competing interests.
Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Stat3 promotes nlrp3 inflammasome activation by mediating nlrp3 mito- chondrial translocation, supplementary table 1, rights and permissions.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/ .
Reprints and permissions
Cite this article.
Luo, L., Wang, F., Xu, X. et al. STAT3 promotes NLRP3 inflammasome activation by mediating NLRP3 mitochondrial translocation. Exp Mol Med (2024). https://doi.org/10.1038/s12276-024-01298-9
Download citation
Received : 15 December 2023
Revised : 10 May 2024
Accepted : 11 June 2024
Published : 02 September 2024
DOI : https://doi.org/10.1038/s12276-024-01298-9
Anyone you share the following link with will be able to read this content:
Sorry, a shareable link is not currently available for this article.
Provided by the Springer Nature SharedIt content-sharing initiative
IMAGES
VIDEO
COMMENTS
Citation. Thorndike, E. L. (1911). Animal intelligence: Experimental studies. Macmillan Press. https:// https://doi.org/10.5962/bhl.title.55072
ONE of the most remarkable examples of sudden and rapid development of a new scientific method and a new and extensive body of scientific fact is to be seen in the growth of the study of animal ...
Animal intelligence : experimental studies by Thorndike, Edward L. (Edward Lee), 1874-1949. Publication date 2000 Topics Animal intelligence Publisher New Brunswick, N.J. : Transaction Publishers Collection internetarchivebooks; printdisabled Contributor Internet Archive Language English
In Edward L. Thorndike's seminal work 'Animal Intelligence: Experimental Studies,' the author delves into the intricacies of animal behavior and cognition through a series of experimental studies. Written in a precise and scientific manner, the book presents Thorndike's pioneering research on learning, problem-solving, and intelligence in various animal species.
Animal Intelligence is a consolidated record of Edward L. Thorndike's theoretical and empirical contributions to the comparative psychology of learning. Thorndike's approach is systematic and comprehensive experimentation using a variety of animals and tasks, all within a laboratory setting. When this book first appeared, it set a compelling example, and helped make the study of animal ...
Experimental Studies. Animal Intelligence is a consolidated record of Edward L. Thorndike's theoretical and empirical contributions to the comparative psychology of learning. Thorndike's approach is systematic and comprehensive experimentation using a variety of animals and tasks, all within a laboratory setting.
This book offers an in-depth exploration into the experimental studies of animal intellect and behavior, marking a significant turning point in the field of psychology and biology. It stands as one of the first comprehensive attempts to apply experimental methods to animal psychology, transitioning from speculative argumentation to rigorous ...
Title. Animal intelligence: Experimental studies. Original Publication. United States: The Macmillan Company,1911. Credits. Emmanuel Ackerman, Kobus Meyer and the Online Distributed Proofreading Team at https: //www.pgdp.net (This file was produced from images generously made available by The Internet Archive) Language.
Citation. Thorndike, E. L. (2000). Animal intelligence: Experimental studies. Transaction Publishers. Abstract. This book, first published in 1911, brings together 5 empirical articles and 2 original essays—one on consciousness and the other on the laws of behavior, notable for its formal statement of the influential Law of Effect.
Animal Intelligence is a consolidated record of Edward L. Thorndike's theoretical and empirical contributions to the comparative psychology of learning. Thorndike's approach is systematic and comprehensive experimentation using a variety of animals and tasks, all within a laboratory setting. When this book first appeared, it set a compelling ...
5.0 3 ratings. See all formats and editions. Animal Intelligence is a consolidated record of Edward L. Thorndike's theoretical and empirical contributions to the comparative psychology of learning. Thorndike's approach is systematic and comprehensive experimentation using a variety of animals and tasks, all within a laboratory setting.
ANIMAL INTELLIGENCE; AN EXPERIMENTAL STUDY OF THE ASSOCIATIVE PRO- CESSES IN ANIMALS. This monograph is an attempt at an explanation of the na- ture of the process of association in the animal mind. ... the study of the animal mind is to learn the developme mental life down throug to trace articular t origin of human aculty. ...
A meta-analysis of 90 experiments from 33 laboratories in 14 countries which yielded an overall effect greater than 6 sigma is reported, indicating that the database is not significantly compromised by either selection bias or by intense " p-hacking"—the selective suppression of findings or analyses that failed to yield statistical significance.
This monograph is an attempt at an explanation of the nature of the process of association in the animal mind. It discusses experiments with cats, dogs, and chicks. Imitation in these animals is discussed as well. ... E. L. (1898). Animal intelligence: An experimental study of the associative processes in animals. The Psychological Review ...
The main purpose of this volume is to make accessible to students of psychology and biology the author's experimental studies of animal intellect and behavior. These studies have, I am informed by teachers of comparative psychology, a twofold interest. Since they represent the first deliberate and extended application of the experimental method in animal psychology, they are a useful ...
The study of consciousness and the study of behavior.--Animal intelligence.--The instinctive reactions of young chicks.--A note on the psychology of fishes.--The mental life of the monkeys.--Law and hypotheses of behavior.--The evolution of the human intellect
Social animals, including rodents, primates, and humans, compete to obtain scarce resources. This social competition gives rise to a social hierarchy within a group, where an individual's social ...
Data from digital sources offer many opportunities to study animal behavior. Following Niko Tinbergen's classical roadmap for behavioral investigation, this essay shows how using videos, photos, text, and audio posted online can shed new light on known behaviors and lead to the discovery of new ones. ... and audio) can complement experimental ...
Reviews the book, Animal Intelligence: Experimental Studies by E. L. Thorndike (1911). The present volume consists mainly of various previously published papers, a few of which have been for some time out of print. In thus bringing together his contributions in the field of animal psychology, Dr. Thorndike has rendered a service for which students of this subject have reason to feel grateful.
That may be due to mishandling in some cases. Anthes notes at the Times that tests for reptile intelligence should take into account normal differences between, say, mammal behavior and reptile behavior: "By using experiments originally designed for mammals, researchers may have been setting reptiles up for failure. For instance, scientists ...
In Edward L. Thorndike's seminal work 'Animal Intelligence: Experimental Studies,' the author delves into the intricacies of animal behavior and cognition through a series of experimental studies. Written in a precise and scientific manner, the book presents Thorndike's pioneering research on learning, problem-solving, and intelligence in ...
Animal Intelligence: Experimental Studies. Animal Intelligence is a consolidated record of Edward L. Thorndike's theoretical and empirical contributions to the comparative psychology of learning. Thorndike's approach is systematic and comprehensive experimentation using a variety of animals and tasks, all within a laboratory setting.
Aqueous amino acid solutions have been introduced as dietary supplements for both animals and humans. This study investigates the physicochemical properties of the solutions containing amino acids ...
Appears in 50 books from 1894-2007. Page 26 - It was merely to put animals when hungry in enclosures from which they could escape by some simple act, such as pulling at a loop of cord, pressing a lever, or stepping on a platform. Appears in 28 books from 1876-2007. Page 31 - O at front."
Excerpt from Animal Intelligence: Experimental Studies The main purpose of this volume is to make accessible to students of psychology and biology the author's experimental studies of animal intellect and behavior. These studies have, I am informed by teachers of comparative psychology, a twofold interest. Since they represent the first ...
This monograph is an attempt at an explanation of the nature of the process of association in the animal mind. Inasmuch as there have been no extended researches of a character similar to the present one either in subject-matter or experimental method, it is necessary to explain briefly its standpoint. Our knowledge of the mental life of animals equals in the main our knowledge of their sense ...
This study provides experimental estimates of the number and percentage of employees aged 18 to 64 in Canada potentially susceptible to AI-related job transformation using the C-AIOE index of Pizzinelli et al. (2023) and data from O*NET and the 2016 and 2021 censuses of population. Occupations were grouped into three distinct categories: (1 ...
The study involved experiments with cell cultures and mice, identifying how STAT3 helps move NLRP3 within cells for activation. This was seen in an experimental study.
Animal intelligence : an experimental study of the associative processes in animals ... Animal intelligence : an experimental study of the associative processes in animals by Thorndike, Edward L. (Edward Lee), 1874-1949. Publication date 1898? Topics Animal intelligence Publisher